TkA03G482820 | RubberDandelionOmics

Gene overview

TkA03G482820

Reference: TK1151 Chr: Chr03 Coordinates: 120765873-120768673 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

908 bp · TkA03G482820|TK1151|cDNA

TCTTCTCCATCTTTTATAAACGATATATTGAAGTGTAGGTTCTCAGTGATCCAGCTCAACGAATGGTATATGATGAAATCCATGGATATGCATTGACTGCAATAAACCCTTTTTATGATGATGCCAGCCCAAAGGATCATGTATTTGTTGATGAGTTTAGTTGTATAGGCTGCAAAAATTGTGCGAATGTTTGCTCGGAAGTCTTTACAATAGAAGAAGACTTTGGTAGAGCCAGAGCATGTAACCAGCAAGGGAGCCTT...

CDS

Download CDS FASTA

1023 bp · TkA03G482820|TK1151|CDS

ATGACTCAATTGTTATCTCCGGTTTGCACAGATCCAATTAAATTTCAAAACGGATTAAGCAGCTTGTGTCCGCCAAGCAGCAGATGGTCGATGTTGGGGACCAACAACAGTATAAAGTGGAACGGAATCGGCCATGGTGAGGGAAGGAGAAGACGATTTGGTAGAGTGAAAGTCGCCACTGATCCGTCGCCGTATTCGTCAGATGCTGTTGCTGATGATTACTATGCTGTCTTAGGACTGCTTCCAGATGCAACACCTGA...

Protein

Download Protein FASTA

340 aa · TkA03G482820|TK1151|PROTEIN

MTQLLSPVCTDPIKFQNGLSSLCPPSSRWSMLGTNNSIKWNGIGHGEGRRRRFGRVKVATDPSPYSSDAVADDYYAVLGLLPDATPEQIKKAYYNCMKSCHPDLSGNNVDTTNFCIFINEVYEVLSDPAQRMVYDEIHGYALTAINPFYDDASPKDHVFVDEFSCIGCKNCANVCSEVFTIEEDFGRARACNQQGSLDLIQQAIDSCPVDCIHWTSAAQVSLLEDEMRRVERVNVALMLAGMGSSADVFRMASTRWEKRQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G482820`
TK1151 ID	TkA03G482820
OH-1004 ID	LXL04_009920
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA03G482820`
Location	Chr03:120765873-120768673 (-)
Description	Similar to DJC76: Chaperone protein dnaJ C76, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_009920` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006260 DNA replication Biological Process GO:0006457 protein folding Biological Process GO:0007005 mitochondrion organization Biological Process GO:0009408 response to heat Biological Process GO:0042026 protein refolding Biological Process GO:0045879 negative regulation of smoothened signaling pathway Biological Process GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0005113 patched binding Molecular Function
KEGG gene cross-reference	ate:Athe_1550 ath:AT5G23240 chy:CHY_0416 csc:Csac_1753 dme:Dmel_CG5504 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.962

Rank 1 · TkA03G482820 · TK1151

Mitochondrion0.039

Rank 2 · TkA03G482820 · TK1151

Nucleus0.037

Rank 3 · TkA03G482820 · TK1151

Cytoplasm0.024

Rank 4 · TkA03G482820 · TK1151

Peroxisome0.015

Rank 5 · TkA03G482820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226DnaJ73-135 aa

PF30912TIM141_C77-109 aa

PF13459Fer4_1581-96 aa

PF12797Fer4_295-100 aa

PF12837Fer4_695-101 aa

PF13187Fer4_995-102 aa

PF14697Fer4_2195-101 aa

PF13237Fer4_1095-100 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G482820	`PF00226`	DnaJ	73	135	5.5e-18	65.6
TkA03G482820	`PF30912`	TIM141_C	77	109	0.034	14.8
TkA03G482820	`PF13459`	Fer4_15	81	96	5.4e-07	30.9
TkA03G482820	`PF12797`	Fer4_2	95	100	0.00047	20.7
TkA03G482820	`PF12837`	Fer4_6	95	101	0.036	14.8
TkA03G482820	`PF13187`	Fer4_9	95	102	0.062	14.1
TkA03G482820	`PF14697`	Fer4_21	95	101	0.066	14.1
TkA03G482820	`PF13237`	Fer4_10	95	100	0.9	10.2
TkA03G482820	`PF12838`	Fer4_7	96	175	0.00051	21.2
TkA03G482820	`PF00037`	Fer4	96	100	0.0072	16.8
TkA03G482820	`PF12800`	Fer4_4	96	101	0.59	11.4
TkA03G482820	`PF13183`	Fer4_8	96	101	1.2	10.5
TkA03G482820	`PF14697`	Fer4_21	156	175	0.066	14.1
TkA03G482820	`PF12797`	Fer4_2	157	176	0.00047	20.7
TkA03G482820	`PF13459`	Fer4_15	158	214	5.4e-07	30.9
TkA03G482820	`PF13237`	Fer4_10	158	187	0.9	10.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card