LXL04_009920 | RubberDandelionOmics

Gene overview

LXL04_009920

Reference: OH-1004 Chr: Chr02 Coordinates: 135961820-135964247 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1023 bp · LXL04_009920|LXL04_009920|OH1004|cDNA

ATGACTCAATTGTTATCTCCGGTTTGCACAGATCCAATTAAATTTCAAAACGGATTAAGCAGCTTGTGTCCGCCAAGCAGCAGATGGTCGATGTTGGGGACCAACAACAGTATAAAGTGGAACGGAATCGGCCATGGTGAGGGAAGGAGAAGACGATTTGGTAGAGTGAAAGTCGCCACTGATCCGTCGCCGTATTCGTCAGATGCTGTTGCTGATGATTACTATGCTGTCTTAGGACTGCTTCCAGATGCAACACCTGA...

CDS

Download CDS FASTA

1023 bp · LXL04_009920|LXL04_009920|OH1004|CDS

ATGACTCAATTGTTATCTCCGGTTTGCACAGATCCAATTAAATTTCAAAACGGATTAAGCAGCTTGTGTCCGCCAAGCAGCAGATGGTCGATGTTGGGGACCAACAACAGTATAAAGTGGAACGGAATCGGCCATGGTGAGGGAAGGAGAAGACGATTTGGTAGAGTGAAAGTCGCCACTGATCCGTCGCCGTATTCGTCAGATGCTGTTGCTGATGATTACTATGCTGTCTTAGGACTGCTTCCAGATGCAACACCTGA...

Protein

Download Protein FASTA

340 aa · LXL04_009920|LXL04_009920|OH1004|PROTEIN

MTQLLSPVCTDPIKFQNGLSSLCPPSSRWSMLGTNNSIKWNGIGHGEGRRRRFGRVKVATDPSPYSSDAVADDYYAVLGLLPDATPEQIKKAYYNCMKSCHPDLSGNNVDTTNFCIFINEVYEVLSDPAQRMVYDEIHGYALTAINPFYDDASPKDHVFVDEFSCIGCKNCANVCSEVFTIEEDFGRARACNQQGSLDLIQQAIDSCPVDCIHWTSAAQVSLLEDEMRRVERVNVALMLAGMGSSADVFRMASTRWEKRQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009920`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009920

Location Chr02:135961820-135964247 (-)

Description Similar to DJC76: Chaperone protein dnaJ C76, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23240`	May function together with HSC70 chaperone to assist protein folding and prevent protein aggregation during salt stress in the chloroplast (Probable).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009920 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0006457 protein folding Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0009408 response to heat Biological Process

GO:0042026 protein refolding Biological Process

GO:0045879 negative regulation of smoothened signaling pathway Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005113 patched binding Molecular Function

KEGG gene cross-reference

ate:Athe_1550

ath:AT5G23240

chy:CHY_0416

csc:Csac_1753

dme:Dmel_CG5504

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.962

Rank 1 · LXL04_009920 · OH-1004

Mitochondrion0.039

Rank 2 · LXL04_009920 · OH-1004

Nucleus0.037

Rank 3 · LXL04_009920 · OH-1004

Cytoplasm0.024

Rank 4 · LXL04_009920 · OH-1004

Peroxisome0.015

Rank 5 · LXL04_009920 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226.37DnaJ73-135 aa

PF13459.12Fer4_15158-214 aa

PF13370.12Fer4_13160-214 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009920	`PF00226.37`	DnaJ	73	135	5.5e-18	65.6
LXL04_009920	`PF13459.12`	Fer4_15	158	214	5.4e-07	30.9
LXL04_009920	`PF13370.12`	Fer4_13	160	214	2.2e-14	54.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMX6`	Arabidopsis thaliana	Chaperone protein dnaJ C76, chloroplastic	35.263%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card