TkA03G313840 | RubberDandelionOmics

Gene overview

TkA03G313840

Reference: TK1151 Chr: Chr03 Coordinates: 77072727-77079338 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3481 bp · TkA03G313840|TK1151|cDNA

AAGCGCCGGCTCTCATCAGATTGTTTTGAAAATTTTGAGACTTCTCTCTTCTTCTCGCCTAGAATCCAATCCCTATTCCCGACTTCTCTCTTCTTCCTGCACGACCTCGCCGTAGGCGGCTACCGGCTACCATCTCGTCCTCCGTCCTCCGTCCTTTGCCTTGCTGTGTGTCGTCGGCGCCTACCCCTGCTTCCTTGCTTAATCTTGCTGTCGTCTTCCTTGCTCCATCTCGTACGCTGCACAGCTTCCGATTCCAGGTG...

CDS

Download CDS FASTA

3039 bp · TkA03G313840|TK1151|CDS

AAGCGCCGGCTCTCATCAGATTGTTTTGAAAATTTTGAGACTTCTCTCTTCTTCTCGCCTAGAATCCAATCCCTATTCCCGACTTCTCTCTTCTTCCTGCACGACCTCGCCGTAGGCGGCTACCGGCTACCATCTCGTCCTCCGTCCTCCGTCCTTTGCCTTGCTGTGTGTCGTCGGCGCCTACCCCTGCTTCCTTGCTTAATCTTGCTGTCGTCTTCCTTGCTCCATCTCGTACGCTGCACAGCTTCCGATTCCAGTCT...

Protein

Download Protein FASTA

1012 aa · TkA03G313840|TK1151|PROTEIN

KRRLSSDCFENFETSLFFSPRIQSLFPTSLFFLHDLAVGGYRLPSRPPSSVLCLAVCRRRLPLLPCLILLSSSLLHLVRCTASDSSLGSSERMAFSTPISSSYLPRVYSQLSAHDAATETKSRIFLSNTSSLLQRSLTYKAGFPSHLERKESYNLKVSASLTTDVSTPELPVKPSVVKGDTWAIHKFGGTCVGTSERIHNVAEIVKEDSSERKLVVVSAMSKVTDMMYDLIEKAQSRDDSYELALDAVFEKHKSTAHDLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G313840`
TK1151 ID	TkA03G313840
OH-1004 ID	LXL04_029365
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	42.500
Protein coverage (%)	TK1151 26.087 / OH-1004 69.892 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G313840

Location Chr03:77072727-77079338 (-)

Description Similar to Bifunctional aspartokinase/homoserine dehydrogenase, chloroplastic (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g19710`	Bifunctional aspartate kinase and homoserine dehydrogenase that catalyzes the first and the third steps toward the synthesis of lysine, methionine and threonine from aspartate.	No verified direct reference in this release
`At1g31230`	Bifunctional aspartate kinase and homoserine dehydrogenase that catalyzes the first and the third steps toward the synthesis of lysine, methionine and threonine from aspartate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029365 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009067 aspartate family amino acid biosynthetic process Biological Process

GO:0009086 methionine biosynthetic process Biological Process

GO:0009088 L-threonine biosynthetic process Biological Process

GO:0009089 L-lysine biosynthetic process via diaminopimelate Biological Process

GO:0009090 L-homoserine biosynthetic process Biological Process

GO:0051289 protein homotetramerization Biological Process

GO:0009507 chloroplast Cellular Component

GO:0004072 aspartate kinase activity Molecular Function

GO:0004412 homoserine dehydrogenase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

bab:bbp_183

bas:BUsg_188

ecj:JW0001

eco:b0002

ecoc:C3026_00010

zma:542249

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.954

Rank 1 · TkA03G313840 · TK1151

Mitochondrion0.062

Rank 2 · TkA03G313840 · TK1151

Cytoplasm0.053

Rank 3 · TkA03G313840 · TK1151

Peroxisome0.039

Rank 4 · TkA03G313840 · TK1151

Nucleus0.025

Rank 5 · TkA03G313840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00696AA_kinase183-464 aa

PF06497Baculo_Ac102199-243 aa

PF13840ACT_7500-562 aa

PF00742Homoserine_dh503-524 aa

PF22468ACT_9505-565 aa

PF01842ACT511-564 aa

PF13740ACT_6516-563 aa

PF13840ACT_7581-644 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G313840	`PF00696`	AA_kinase	183	464	3.4e-44	152.1
TkA03G313840	`PF06497`	Baculo_Ac102	199	243	0.089	13.6
TkA03G313840	`PF13840`	ACT_7	500	562	1.2e-19	70.6
TkA03G313840	`PF00742`	Homoserine_dh	503	524	7.4e-53	179.7
TkA03G313840	`PF22468`	ACT_9	505	565	5.3e-43	145.3
TkA03G313840	`PF01842`	ACT	511	564	2.1e-15	56.9
TkA03G313840	`PF13740`	ACT_6	516	563	0.027	15.0
TkA03G313840	`PF13840`	ACT_7	581	644	1.2e-19	70.6
TkA03G313840	`PF22468`	ACT_9	587	646	5.3e-43	145.3
TkA03G313840	`PF01842`	ACT	593	634	2.1e-15	56.9
TkA03G313840	`PF13740`	ACT_6	596	619	0.027	15.0
TkA03G313840	`PF24367`	DUF7523	599	643	0.22	12.5
TkA03G313840	`PF03447`	NAD_binding_3	659	795	3.4e-22	80.1
TkA03G313840	`PF06497`	Baculo_Ac102	668	679	0.089	13.6
TkA03G313840	`PF00742`	Homoserine_dh	803	1001	7.4e-53	179.7
TkA03G313840	`PF13740`	ACT_6	994	1008	0.027	15.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81852`	Arabidopsis thaliana	sp\|O81852\|AKH2_ARATH Bifunctional aspartokinase/homoserine dehydrogenase 2, chloroplastic	75.900%	Swiss-Prot	High
`Q9SA18`	Arabidopsis thaliana	sp\|Q9SA18\|AKH1_ARATH Bifunctional aspartokinase/homoserine dehydrogenase 1, chloroplastic	75.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card