TkA03G286260 | RubberDandelionOmics

Gene overview

TkA03G286260

Reference: TK1151 Chr: Chr03 Coordinates: 70668745-70671393 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2098 bp · TkA03G286260|TK1151|cDNA

ATATGTGTAAAATCATGTTTTTTTTTTAGATTGGGAGGGAAAGAAATTTCGCTCGTTGTTTCAATTTCAAAACACAGGGAGAAATGATAAAAGCAGTTGGCCCCACAACTGCACGCACTTTCATCATCATCTCTCGAAATCCTTTCCCCTCGTCGCATTTTTTCGATCTTACTATTTCCTCGTCACCTGAATAACTGGTTGTTTGTGATGGATTCTACTGCACAAAATCGTGTGCACCCAATCAAGCTATGGCCTCCAAG...

CDS

Download CDS FASTA

1623 bp · TkA03G286260|TK1151|CDS

ATGGATTCTACTGCACAAAATCGTGTGCACCCAATCAAGCTATGGCCTCCAAGCCAAAACATAAGGCAAGTACTTATAGACCGCATAATAAATAACCTCACAAGTCCTTCACTTTTATCCAGAAAGTACGGTATTTTAACCAAAGAAGATGCAGAAGAAGAAGCTAAACGAATAGAATCTTTAGCCTTTATTACTGCAAATCAACTCTTTGAAAAAGAACCAGATAGTGATGGAGCTTCTTCTGTCCAAGTTTATGCTAA...

Protein

Download Protein FASTA

540 aa · TkA03G286260|TK1151|PROTEIN

MDSTAQNRVHPIKLWPPSQNIRQVLIDRIINNLTSPSLLSRKYGILTKEDAEEEAKRIESLAFITANQLFEKEPDSDGASSVQVYAKESSTLMVETVKRGPKIKQEENQNQNQNESQSHHTYFDISGGDRAFLDAEKAQELLKPLQDPQNKFTKICFSNTSFGVDAARVAVPILTSVKHQLKEVNLSDFIAGRPEEEALEVMSMFSKALEGSNLRYLCLSNNALGEKGVRAFSELLSSQNTLEELYLINNGISEEAAKAV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G286260`
TK1151 ID	TkA03G286260
OH-1004 ID	LXL04_018823
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.900
Protein coverage (%)	TK1151 98.704 / OH-1004 83.151 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G286260

Location Chr03:70668745-70671393 (-)

Description Similar to RANGAP1: RAN GTPase-activating protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19320`	GTPase activator for the nuclear Ras-related regulatory protein Ran, converting it to the putatively inactive GDP-bound state.	No verified direct reference in this release
`At3g63130`	GTPase activator for the nuclear Ras-related regulatory protein Ran, converting it to the putatively inactive GDP-bound state.	Plant RanGAPs are localized at the nuclear envelope in interphase and associated with microtubules in mitotic cells.2002 · DOI: 10.1046/j.1365-313x.2002.01324.x RanGAP1 is a continuous marker of the Arabidopsis cell division plane.2008 · DOI: 10.1073/pnas.0806157105
`At1g47200`	Regulates the mitotic activity in roots.	Arabidopsis WPP-domain proteins are developmentally associated with the nuclear envelope and promote cell division.2004 · DOI: 10.1105/tpc.104.026740 WPP-domain proteins mimic the activity of the HSC70-1 chaperone in preventing mistargeting of RanGAP1-anchoring protein WIT1.2009 · DOI: 10.1104/pp.109.143404
`At5g43070`	Regulates the mitotic activity in roots.	Arabidopsis WPP-domain proteins are developmentally associated with the nuclear envelope and promote cell division.2004 · DOI: 10.1105/tpc.104.026740 WPP-domain proteins mimic the activity of the HSC70-1 chaperone in preventing mistargeting of RanGAP1-anchoring protein WIT1.2009 · DOI: 10.1104/pp.109.143404

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018823 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0007165 signal transduction Biological Process

GO:0007249 canonical NF-kappaB signal transduction Biological Process

GO:0031396 regulation of protein ubiquitination Biological Process

GO:0032496 response to lipopolysaccharide Biological Process

GO:0032687 negative regulation of interferon-alpha production Biological Process

GO:0032688 negative regulation of interferon-beta production Biological Process

GO:0032691 negative regulation of interleukin-1 beta production Biological Process

GO:0032695 negative regulation of interleukin-12 production Biological Process

GO:0032715 negative regulation of interleukin-6 production Biological Process

KEGG gene cross-reference

ath:AT3G63130

ath:AT5G19320

mmu:268857

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.594

Rank 1 · TkA03G286260 · TK1151

Nucleus0.561

Rank 2 · TkA03G286260 · TK1151

Mitochondrion0.059

Rank 3 · TkA03G286260 · TK1151

Cell membrane0.027

Rank 4 · TkA03G286260 · TK1151

Endoplasmic reticulum0.020

Rank 5 · TkA03G286260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13943WPP12-106 aa

PF10007DUF225021-49 aa

PF10007DUF225094-126 aa

PF29265LRR_CARMIL115-190 aa

PF29255LRR_NLRC3156-188 aa

PF27087LRR_TMOD-LMOD178-278 aa

PF12799LRR_4179-188 aa

PF13516LRR_6181-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G286260	`PF13943`	WPP	12	106	9.6e-32	110.2
TkA03G286260	`PF10007`	DUF2250	21	49	0.016	16.0
TkA03G286260	`PF10007`	DUF2250	94	126	0.016	16.0
TkA03G286260	`PF29265`	LRR_CARMIL	115	190	5.3e-20	72.3
TkA03G286260	`PF29255`	LRR_NLRC3	156	188	9.8e-36	124.1
TkA03G286260	`PF27087`	LRR_TMOD-LMOD	178	278	1.4e-12	48.2
TkA03G286260	`PF12799`	LRR_4	179	188	5.4e-08	33.5
TkA03G286260	`PF13516`	LRR_6	181	188	2e-18	65.6
TkA03G286260	`PF29247`	LRR_MHP1-HER1-GIP3	198	298	8.1e-07	29.3
TkA03G286260	`PF29255`	LRR_NLRC3	209	346	9.8e-36	124.1
TkA03G286260	`PF29265`	LRR_CARMIL	209	489	5.3e-20	72.3
TkA03G286260	`PF13855`	LRR_8	212	250	0.27	11.7
TkA03G286260	`PF13516`	LRR_6	213	233	2e-18	65.6
TkA03G286260	`PF00560`	LRR_1	213	234	3.2e-11	41.8
TkA03G286260	`PF12799`	LRR_4	213	252	5.4e-08	33.5
TkA03G286260	`PF29252`	LRR_NLRC4	224	301	0.00021	21.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M651`	Arabidopsis thaliana	sp\|Q9M651\|RAGP2_ARATH RAN GTPase-activating protein 2	65.900%	Swiss-Prot	High
`Q9LE82`	Arabidopsis thaliana	sp\|Q9LE82\|RAGP1_ARATH RAN GTPase-activating protein 1	61.600%	Swiss-Prot	High
`Q9C500`	Arabidopsis thaliana	sp\|Q9C500\|WPP2_ARATH WPP domain-containing protein 2	37.900%	Swiss-Prot	Low
`Q9FMH6`	Arabidopsis thaliana	sp\|Q9FMH6\|WPP1_ARATH WPP domain-containing protein 1	37.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card