Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1926 bp · LXL04_018823|LXL04_018823|OH1004|cDNA
ATGGATTCTACTGCACAAAATCGTGTGCACTCAATCAAGCTATGGCCTCCAAGCCAAAACACAAGGCAAGTACTTATAGACCGCATAATAAATAACCTCACAAGTCCTTCACTTTTATCCAGAAAATGCGGTATTTTAACcaaagaagaagcagaagaagaagcTAAACGAATAGAATCTTTAGCTTTTGTTACTGCAAATCAACTCTTTGAAAAAGAACCAGATAGTGATGGAGCTTCTTCTGTCCAAGTTTATGCTAA...
1926 bp · LXL04_018823|LXL04_018823|OH1004|CDS
ATGGATTCTACTGCACAAAATCGTGTGCACTCAATCAAGCTATGGCCTCCAAGCCAAAACACAAGGCAAGTACTTATAGACCGCATAATAAATAACCTCACAAGTCCTTCACTTTTATCCAGAAAATGCGGTATTTTAACCAAAGAAGAAGCAGAAGAAGAAGCTAAACGAATAGAATCTTTAGCTTTTGTTACTGCAAATCAACTCTTTGAAAAAGAACCAGATAGTGATGGAGCTTCTTCTGTCCAAGTTTATGCTAA...
Protein
Download Protein FASTA641 aa · LXL04_018823|LXL04_018823|OH1004|PROTEIN
MDSTAQNRVHSIKLWPPSQNTRQVLIDRIINNLTSPSLLSRKCGILTKEEAEEEAKRIESLAFVTANQLFEKEPDSDGASSVQVYAKESSTLMVETVKRGPKIKQEENQNQNQNESQSHHTYFDISGGDRAFLDAEKAQELLKPLQDPQNKFTKICFSNTSFGVDAARVAVPILTSVKHQLKEVNLSDFIAGRPEEEALEVMSMFSKALEGSNLRYLCLSNNALGEKGVRAFSELLSSQNTLEELFLINNGISEEAAKAV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_018823 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_018823 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:18667888-18675569 (+) | |||||||||
| Description | Similar to RANGAP1: RAN GTPase-activating protein 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000911 cytokinesis by cell plate formation Biological Process GO:0006606 protein import into nucleus Biological Process GO:0006913 nucleocytoplasmic transport Biological Process GO:0007165 signal transduction Biological Process GO:0007249 canonical NF-kappaB signal transduction Biological Process GO:0031396 regulation of protein ubiquitination Biological Process GO:0032496 response to lipopolysaccharide Biological Process GO:0032687 negative regulation of interferon-alpha production Biological Process GO:0032688 negative regulation of interferon-beta production Biological Process GO:0032691 negative regulation of interleukin-1 beta production Biological Process GO:0032695 negative regulation of interleukin-12 production Biological Process GO:0032715 negative regulation of interleukin-6 production Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT3G63130 ath:AT5G19320 mmu:268857 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13943.12WPP11-106 aaPF27087.1LRR_TMOD-LMOD178-278 aaPF29265.1LRR_CARMIL209-490 aaPF29255.1LRR_NLRC3213-464 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_018823 | PF13943.12 | WPP | 11 | 106 | 3.2e-32 | 111.8 |
| LXL04_018823 | PF27087.1 | LRR_TMOD-LMOD | 178 | 278 | 7.1e-12 | 45.9 |
| LXL04_018823 | PF29265.1 | LRR_CARMIL | 209 | 490 | 2.2e-19 | 70.2 |
| LXL04_018823 | PF29255.1 | LRR_NLRC3 | 213 | 464 | 1.7e-34 | 119.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.