TkA02G420790 | RubberDandelionOmics

Gene overview

TkA02G420790

Reference: TK1151 Chr: Chr02 Coordinates: 106867891-106872586 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1299 bp · TkA02G420790|TK1151|cDNA

ATGGCCACTTCAATTCTCCTTTCCAGTTCCTTCTCTTGCGTTCCTCGATTACACCGAAGCCCCAAATTCATCTTCTCCCCGCTCAAACTCAATCGCAGTGCAACACAGAGTCACAGTAATTCGAATAGAGGTTTCCTAAAGACCACCCAATTACTGCCTTCCAACTGTTTCAGAAAAAGCCGCAGAATATTCGTTATCGGAGAATCCGATACGAGTGTTTCCAAGGATGTTCTGGTGGGCGAGGACTCTGCAAATTTCGA...

CDS

Download CDS FASTA

1299 bp · TkA02G420790|TK1151|CDS

ATGGCCACTTCAATTCTCCTTTCCAGTTCCTTCTCTTGCGTTCCTCGATTACACCGAAGCCCCAAATTCATCTTCTCCCCGCTCAAACTCAATCGCAGTGCAACACAGAGTCACAGTAATTCGAATAGAGGTTTCCTAAAGACCACCCAATTACTGCCTTCCAACTGTTTCAGAAAAAGCCGCAGAATATTCGTTATCGGAGAATCCGATACGAGTGTTTCCAAGGATGTTCTGGTGGGCGAGGACTCTGCAAATTTCGA...

Protein

Download Protein FASTA

432 aa · TkA02G420790|TK1151|PROTEIN

MATSILLSSSFSCVPRLHRSPKFIFSPLKLNRSATQSHSNSNRGFLKTTQLLPSNCFRKSRRIFVIGESDTSVSKDVLVGEDSANFDLAKQKITSWIYFTVVLGVVLFILDIAWLDNSTGFGKVFIDSVSSVSDSPEVVMFLLTLIFAVVHSGLASVRDPGEKLIGERAFRVLFAGTSLPLAVSTIVYFINHRYDGVQLWQLQSVPWLHYLLWITNFISFFFLYPSTFNLLEVAAVDKPKMHLWESGIMRITRHPQVMWC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G420790`
TK1151 ID	TkA02G420790
OH-1004 ID	LXL04_014497
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	83.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G420790

Location Chr02:106867891-106872586 (-)

Description Similar to Z-ISO: 15-cis-zeta-carotene isomerase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10830`	Isomerase involved in the biosynthesis of carotenoids.	Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoid biosynthesis in plants.2010 · DOI: 10.1104/pp.110.153916
`At1g60730`	Probable aldo-keto reductase 5.	No verified direct reference in this release
`At1g60750`	Probable aldo-keto reductase 6.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2XRZ0`	Probable aldo-keto reductase 2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014497 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016120 carotene biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0008106 alcohol dehydrogenase (NADP+) activity Molecular Function

GO:0090471 9,15,9'-tri-cis-zeta-carotene isomerase activity Molecular Function

KEGG gene cross-reference

ath:AT1G10830

ath:AT1G60680

ath:AT1G60710

ath:AT1G60730

zma:100194203

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.970

Rank 1 · TkA02G420790 · TK1151

Mitochondrion0.031

Rank 2 · TkA02G420790 · TK1151

Nucleus0.020

Rank 3 · TkA02G420790 · TK1151

Cytoplasm0.018

Rank 4 · TkA02G420790 · TK1151

Cell membrane0.013

Rank 5 · TkA02G420790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07298NnrU98-110 aa

PF07298NnrU139-316 aa

PF00248Aldo_ket_red340-413 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G420790	`PF07298`	NnrU	98	110	2.2e-29	103.1
TkA02G420790	`PF07298`	NnrU	139	316	2.2e-29	103.1
TkA02G420790	`PF00248`	Aldo_ket_red	340	413	1.4e-11	44.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SAC0`	Arabidopsis thaliana	sp\|Q9SAC0\|ZCIS_ARATH 15-cis-zeta-carotene isomerase, chloroplastic	75.600%	Swiss-Prot	High
`Q9ASZ9`	Arabidopsis thaliana	sp\|Q9ASZ9\|ALKR5_ARATH Probable aldo-keto reductase 5	51.300%	Swiss-Prot	Low
`F4HPY8`	Arabidopsis thaliana	sp\|F4HPY8\|ALKR6_ARATH Probable aldo-keto reductase 6	56.300%	Swiss-Prot	Low
`A2XRZ0`	Oryza sativa subsp. indica	sp\|A2XRZ0\|AKR2_ORYSI Probable aldo-keto reductase 2	57.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card