LXL04_014497 | RubberDandelionOmics

Gene overview

LXL04_014497

Reference: OH-1004 Chr: Chr03 Coordinates: 50593519-50598217 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1669 bp · LXL04_014497|LXL04_014497|OH1004|cDNA

ATAACACAAAAACCATACCAACAGCACAACTCCATCCAGATACCCTTTTTCTTGGACTTGGGTACAAAATGCTTAAAATAAACACACACCCAAAATGCAAACCAACTaacaaatggcaacttcaatTCTCCTTTCCAGTTCCTTCTCTTGCTTTCCTCGATTACACCGAAGCCCCAAATTCATCTTCTCCCCGCTCAAACTCAATCGCAGTGCAACACAGAGTCACAGTAATTCGAATAGAGGTTTCCTAAAGACCACCC...

CDS

Download CDS FASTA

1557 bp · LXL04_014497|LXL04_014497|OH1004|CDS

ATGGCAACTTCAATTCTCCTTTCCAGTTCCTTCTCTTGCTTTCCTCGATTACACCGAAGCCCCAAATTCATCTTCTCCCCGCTCAAACTCAATCGCAGTGCAACACAGAGTCACAGTAATTCGAATAGAGGTTTCCTAAAGACCACCCAATTACTGCCTTCCAACTGTTTCAGAAAAAGCCGCAGAATATTCGTTATCGGAGAATCCGATACGAGTGTTTCCAAGGATGTTCTGGTGGGCGAGGACTCTGCAAATTTCGA...

Protein

Download Protein FASTA

518 aa · LXL04_014497|LXL04_014497|OH1004|PROTEIN

MATSILLSSSFSCFPRLHRSPKFIFSPLKLNRSATQSHSNSNRGFLKTTQLLPSNCFRKSRRIFVIGESDTSVSKDVLVGEDSANFDLAKQKITSWIYFTVVLGVVLFILDIAWLDNSTGFGKVFIDSVSSVSDSPEVVMFLLTLIFAVVHSGLASVRDPGEKLIGERAFRVLFAGTSLPLAVSTIVYFINHRYDGVQLWQLQSVPWLHYLLWITNFISFFFLYPSTFNLLEVAAVDKPKMHLWESGIMRITRHPQLVGQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014497`
TK1151 ID	TkA02G420790
OH-1004 ID	LXL04_014497
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	83.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014497

Location Chr03:50593519-50598217 (+)

Description Similar to Z-ISO: 15-cis-zeta-carotene isomerase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10830`	Isomerase involved in the biosynthesis of carotenoids.	Isolation and characterization of the Z-ISO gene encoding a missing component of carotenoid biosynthesis in plants.2010 · DOI: 10.1104/pp.110.153916
`At1g60730`	Probable aldo-keto reductase 5.	No verified direct reference in this release
`At1g60710`	Probable aldo-keto reductase 4.	No verified direct reference in this release
`At1g60680`	Probable aldo-keto reductase 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014497 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016120 carotene biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0008106 alcohol dehydrogenase (NADP+) activity Molecular Function

GO:0090471 9,15,9'-tri-cis-zeta-carotene isomerase activity Molecular Function

KEGG gene cross-reference

ath:AT1G10830

ath:AT1G60680

ath:AT1G60710

ath:AT1G60730

zma:100194203

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.975

Rank 1 · LXL04_014497 · OH-1004

Mitochondrion0.027

Rank 2 · LXL04_014497 · OH-1004

Nucleus0.020

Rank 3 · LXL04_014497 · OH-1004

Cytoplasm0.019

Rank 4 · LXL04_014497 · OH-1004

Cell membrane0.014

Rank 5 · LXL04_014497 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07298.17NnrU139-357 aa

PF00248.28Aldo_ket_red396-499 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014497	`PF07298.17`	NnrU	139	357	3.5e-34	118.8
LXL04_014497	`PF00248.28`	Aldo_ket_red	396	499	2e-15	57.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SAC0`	Arabidopsis thaliana	15-cis-zeta-carotene isomerase, chloroplastic	75.585%	Swiss-Prot	moderate database homology
`Q9ASZ9`	Arabidopsis thaliana	Probable aldo-keto reductase 5	44.898%	Swiss-Prot	weak database homology
`Q93ZN2`	Arabidopsis thaliana	Probable aldo-keto reductase 4	56.693%	Swiss-Prot	weak database homology
`Q84M96`	Arabidopsis thaliana	Probable aldo-keto reductase 2	56.349%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card