TkA02G164700 | RubberDandelionOmics

Gene overview

TkA02G164700

Reference: TK1151 Chr: Chr02 Coordinates: 42273570-42278480 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3067 bp · TkA02G164700|TK1151|cDNA

TGAAACCCCATTTCCTGGTCATGACGTTGTCTGTTAAACCCAAAACCCCTTTTCCTCCCTCCAAATACCTCTTATCTAATGACTTCATCACTCTCACTAGTCACTCGAGTTCCTCTCCGGCCAACAAACGACTGCTCTCCTACTAATGGGAGCATCGCTCACCGGCGATCCGTCGTGTTTCCTTTCAAGAAATGGAGGTGTTCAATATCTCCCGGCCAGCCGCCTCCGCCTCCCCCAAAACAGCGGCAGCGGCAGTCCAA...

CDS

Download CDS FASTA

2760 bp · TkA02G164700|TK1151|CDS

ATGACTTCATCACTCTCACTAGTCACTCGAGTTCCTCTCCGGCCAACAAACGACTGCTCTCCTACTAATGGGAGCATCGCTCACCGGCGATCCGTCGTGTTTCCTTTCAAGAAATGGAGGTGTTCAATATCTCCCGGCCAGCCGCCTCCGCCTCCCCCAAAACAGCGGCAGCGGCAGTCCAAGAGCTCAGAATCAGGCGAAAAAGGAATCGATCCTGTTGGGTTTCTCTCAAAAGCCGGAATTACACACAAAGGTTTCGC...

Protein

Download Protein FASTA

919 aa · TkA02G164700|TK1151|PROTEIN

MTSSLSLVTRVPLRPTNDCSPTNGSIAHRRSVVFPFKKWRCSISPGQPPPPPPKQRQRQSKSSESGEKGIDPVGFLSKAGITHKGFALYLRERYKSYKDLKDEILTRHIDFRDMASGFELLGMHRNVQHRVDFMDWAPGARYSAIVGDFNDWSPTENSAREGHFGHDDYGYWFIILEDKLRDGEHPDELYFQQYNYTDDYDKGDSGVTAEEIFQKANDEYWEPGEDRLVKSRFEIIAKLYEQIFGPNGPQTEEELEEIPD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G164700`
TK1151 ID	TkA02G164700
OH-1004 ID	LXL04_016253
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 96.300 / OH-1004 98.883 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G164700

Location Chr02:42273570-42278480 (+)

Description Similar to SBE3: 1,4-alpha-glucan-branching enzyme 3, chloroplastic/amyloplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20440`	Catalyzes the formation of the alpha-1,6-glucosidic linkages in starch by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position.	The Arabidopsis BE1 gene, encoding a putative glycoside hydrolase localized in plastids, plays crucial roles during embryogenesis and carbohydrate metabolism.2010 · DOI: 10.1111/j.1744-7909.2010.00930.x
`At2g36390`	Catalyzes the formation of the alpha-1,6-glucosidic linkages in starch by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016253 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0005978 glycogen biosynthetic process Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009501 amyloplast Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003844 1,4-alpha-glucan branching enzyme activity Molecular Function

GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds Molecular Function

KEGG gene cross-reference

ath:AT3G20440

ecb:100034152

fca:493962

mmu:74185

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.847

Rank 1 · TkA02G164700 · TK1151

Cytoplasm0.085

Rank 2 · TkA02G164700 · TK1151

Cell membrane0.071

Rank 3 · TkA02G164700 · TK1151

Nucleus0.048

Rank 4 · TkA02G164700 · TK1151

Mitochondrion0.044

Rank 5 · TkA02G164700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02922CBM_48121-182 aa

PF02922CBM_48318-359 aa

PF02806Alpha-amylase_C326-348 aa

PF00128Alpha-amylase424-493 aa

PF00128Alpha-amylase527-561 aa

PF02806Alpha-amylase_C798-885 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G164700	`PF02922`	CBM_48	121	182	6.8e-08	33.4
TkA02G164700	`PF02922`	CBM_48	318	359	6.8e-08	33.4
TkA02G164700	`PF02806`	Alpha-amylase_C	326	348	1.6e-19	70.7
TkA02G164700	`PF00128`	Alpha-amylase	424	493	3.6e-09	37.0
TkA02G164700	`PF00128`	Alpha-amylase	527	561	3.6e-09	37.0
TkA02G164700	`PF02806`	Alpha-amylase_C	798	885	1.6e-19	70.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`D2WL32`	Arabidopsis thaliana	sp\|D2WL32\|GLGB3_ARATH 1,4-alpha-glucan-branching enzyme 3, chloroplastic/amyloplastic	74.000%	Swiss-Prot	High
`O23647`	Arabidopsis thaliana	sp\|O23647\|GLGB1_ARATH 1,4-alpha-glucan-branching enzyme 2-1, chloroplastic/amyloplastic	45.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card