LXL04_016253 | RubberDandelionOmics

Gene overview

LXL04_016253

Reference: OH-1004 Chr: Chr03 Coordinates: 116581571-116586002 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2688 bp · LXL04_016253|LXL04_016253|OH1004|cDNA

ATGACTTCATCACTCTCACTAGTCACTCGAGTTCCTCTCCGGCCAACAAACGACTGCTCTCCTACTAATGGGAGCATCGCTCACCGGCGATCCGTCGTGTTTCCTTTCAAGAAATGGAGGTGCTCAATATCTCCCGGCCAGCCGCCTCCGCCTCCCCCAAAACAGCGGCAGCGGCAGTCCAAGAGCTCAGAATCAGGCGAAAAAGGAATCGATCCTGTTGGGTTTCTCTCAAAAGCCGGAATTACACACAAAGGTTTCGC...

CDS

Download CDS FASTA

2688 bp · LXL04_016253|LXL04_016253|OH1004|CDS

ATGACTTCATCACTCTCACTAGTCACTCGAGTTCCTCTCCGGCCAACAAACGACTGCTCTCCTACTAATGGGAGCATCGCTCACCGGCGATCCGTCGTGTTTCCTTTCAAGAAATGGAGGTGCTCAATATCTCCCGGCCAGCCGCCTCCGCCTCCCCCAAAACAGCGGCAGCGGCAGTCCAAGAGCTCAGAATCAGGCGAAAAAGGAATCGATCCTGTTGGGTTTCTCTCAAAAGCCGGAATTACACACAAAGGTTTCGC...

Protein

Download Protein FASTA

895 aa · LXL04_016253|LXL04_016253|OH1004|PROTEIN

MTSSLSLVTRVPLRPTNDCSPTNGSIAHRRSVVFPFKKWRCSISPGQPPPPPPKQRQRQSKSSESGEKGIDPVGFLSKAGITHKGFALYLRERYKSYKDLKDEILTRHIDFRDMASGFELLGMHRNVQHRVDFMDWAPGARYSAIVGDFNDWSPTENSAREGHFGHDDYGYWFIILEDKLRDGEHPDELYFQQYNYTDDYDKGDSGVTAEEIFQKANDEYWEPGEDRLVKSRFEIIAKLYEQIFGPNGPQTEDELEEIPD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016253`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016253

Location Chr03:116581571-116586002 (-)

Description Similar to SBE3: 1,4-alpha-glucan-branching enzyme 3, chloroplastic/amyloplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20440`	Catalyzes the formation of the alpha-1,6-glucosidic linkages in starch by scission of a 1,4-alpha-linked oligosaccharide from growing alpha-1,4-glucan chains and the subsequent attachment of the oligosaccharide to the alpha-1,6 position.	The Arabidopsis BE1 gene, encoding a putative glycoside hydrolase localized in plastids, plays crucial roles during embryogenesis and carbohydrate metabolism.2010 · DOI: 10.1111/j.1744-7909.2010.00930.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016253 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0005978 glycogen biosynthetic process Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009501 amyloplast Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003844 1,4-alpha-glucan branching enzyme activity Molecular Function

GO:0004553 hydrolase activity, hydrolyzing O-glycosyl compounds Molecular Function

KEGG gene cross-reference

ath:AT3G20440

ecb:100034152

fca:493962

mmu:74185

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.895

Rank 1 · LXL04_016253 · OH-1004

Cytoplasm0.071

Rank 2 · LXL04_016253 · OH-1004

Cell membrane0.061

Rank 3 · LXL04_016253 · OH-1004

Mitochondrion0.039

Rank 4 · LXL04_016253 · OH-1004

Nucleus0.038

Rank 5 · LXL04_016253 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02922.25CBM_48121-182 aa

PF00128.32Alpha-amylase424-493 aa

PF02806.25Alpha-amylase_C798-889 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016253	`PF02922.25`	CBM_48	121	182	6.4e-08	33.5
LXL04_016253	`PF00128.32`	Alpha-amylase	424	493	9.3e-10	39.0
LXL04_016253	`PF02806.25`	Alpha-amylase_C	798	889	2e-21	76.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`D2WL32`	Arabidopsis thaliana	1,4-alpha-glucan-branching enzyme 3, chloroplastic/amyloplastic	70.588%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card