TkA02G091490 | RubberDandelionOmics

Gene overview

TkA02G091490

Reference: TK1151 Chr: Chr02 Coordinates: 23827192-23828111 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

723 bp · TkA02G091490|TK1151|cDNA

ATGAGAGCAATGAAAGAGTTTAGACAAGGAGAACTTGAAGAGAAGAAGCACCCAAAACTTCTCAAGACACCATCTTTAGGCCTTTGCAAGCTACAAGACACCTCCAAGATCGAAAACGAAGCTCGTATATTATCGTCTTTTGCACAGAATCGGTTCTTGGTCAACTTACTCGGGACGAGTCATGACTCAGCCGGGCACCGAGTCCTTGTCATGGAACACATGCCGGTGGCATGCTTCATGACTTGCTACATATCACCATT...

CDS

Download CDS FASTA

723 bp · TkA02G091490|TK1151|CDS

ATGAGAGCAATGAAAGAGTTTAGACAAGGAGAACTTGAAGAGAAGAAGCACCCAAAACTTCTCAAGACACCATCTTTAGGCCTTTGCAAGCTACAAGACACCTCCAAGATCGAAAACGAAGCTCGTATATTATCGTCTTTTGCACAGAATCGGTTCTTGGTCAACTTACTCGGGACGAGTCATGACTCAGCCGGGCACCGAGTCCTTGTCATGGAACACATGCCGGTGGCATGCTTCATGACTTGCTACATATCACCATT...

Protein

Download Protein FASTA

240 aa · TkA02G091490|TK1151|PROTEIN

MRAMKEFRQGELEEKKHPKLLKTPSLGLCKLQDTSKIENEARILSSFAQNRFLVNLLGTSHDSAGHRVLVMEHMPVACFMTCYISPLVALLHHHVERQTGDFGLSVCINSPSQLANSVSLPAELSDTWILVTLPQSKLSTKNDVFSFGVVLLEIISGTKAIDVSRAPASIVEWARGMFEKDQVMEICDKKVKMPRHMEDMIRRMLVLAMRCVSSDEESRPSITEIVTELERFRFHYGQIR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G091490`
TK1151 ID	TkA02G091490
OH-1004 ID	LXL04_016934
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	64.500
Protein coverage (%)	TK1151 97.500 / OH-1004 82.825 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G091490

Location Chr02:23827192-23828111 (-)

Description Similar to At5g23170: Serine/threonine-protein kinase-like protein At5g23170

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23170`	Serine/threonine-protein kinase-like protein At5g23170.	No verified direct reference in this release
`At3g51990`	Serine/threonine-protein kinase-like protein At3g51990.	No verified direct reference in this release
`At1g28390`	Serine/threonine-protein kinase-like protein At1g28390.	No verified direct reference in this release
`At3g09780`	Serine/threonine-protein kinase with low activity.	No verified direct reference in this release
`At2g39180`	Serine/threonine-protein kinase with low activity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016934 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009786 regulation of asymmetric cell division Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010311 lateral root formation Biological Process

GO:0032877 positive regulation of DNA endoreduplication Biological Process

GO:0048364 root development Biological Process

GO:0048829 root cap development Biological Process

GO:0090392 sepal giant cell differentiation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009986 cell surface Cellular Component

KEGG gene cross-reference

ath:AT1G28390

ath:AT3G51990

ath:AT3G59420

ath:AT4G34500

ath:AT5G23170

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.413

Rank 1 · TkA02G091490 · TK1151

Cytoplasm0.376

Rank 2 · TkA02G091490 · TK1151

Nucleus0.260

Rank 3 · TkA02G091490 · TK1151

Endoplasmic reticulum0.082

Rank 4 · TkA02G091490 · TK1151

Golgi apparatus0.058

Rank 5 · TkA02G091490 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr31-78 aa

PF00069Pkinase33-76 aa

PF07714PK_Tyr_Ser-Thr94-229 aa

PF00069Pkinase95-227 aa

PF26031IREH1177-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G091490	`PF07714`	PK_Tyr_Ser-Thr	31	78	4.1e-14	53.2
TkA02G091490	`PF00069`	Pkinase	33	76	1.1e-09	38.8
TkA02G091490	`PF07714`	PK_Tyr_Ser-Thr	94	229	4.1e-14	53.2
TkA02G091490	`PF00069`	Pkinase	95	227	1.1e-09	38.8
TkA02G091490	`PF26031`	IREH1	177	231	0.11	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMY3`	Arabidopsis thaliana	sp\|Q9FMY3\|STPKL_ARATH Serine/threonine-protein kinase-like protein At5g23170	32.900%	Swiss-Prot	Medium
`Q9SV05`	Arabidopsis thaliana	sp\|Q9SV05\|CCR35_ARATH Serine/threonine-protein kinase-like protein At3g51990	37.700%	Swiss-Prot	Medium
`Q9SGN7`	Arabidopsis thaliana	sp\|Q9SGN7\|CCR12_ARATH Serine/threonine-protein kinase-like protein At1g28390	43.600%	Swiss-Prot	Low
`Q9S7D9`	Arabidopsis thaliana	sp\|Q9S7D9\|ACCR1_ARATH Serine/threonine-protein kinase-like protein CCR1	32.500%	Swiss-Prot	Medium
`O80963`	Arabidopsis thaliana	sp\|O80963\|ACCR2_ARATH Serine/threonine-protein kinase-like protein CCR2	29.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card