RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G042500
Reference: TK1151 Chr: Chr02 Coordinates: 10746827-10753008 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2354 bp · TkA02G042500|TK1151|cDNA

TTCCGATTTGTACTTGGTATACAATTATAATCGTGCCCCTTAAGCTTTGCCTCCTCATTGCAAGTAAACCCCCTTTTCCTTCCCATTATTCGCCGGCATTCTCACCTGTTTTCAACTCGATCGTTCCGTTTAACACCTACTCAAATCATCAAAACCCTCAAATCGACTCATCGATTATCGATTACAAGGGCTTATTGATCAAGTTTTGCACGTTTACACCCGCCGTTTGTGAATTGCGATGGAAGAGGAGGATTGCATGA...

CDS

Download CDS FASTA

1818 bp · TkA02G042500|TK1151|CDS

ATGGAAGAGGAGGATTGCATGAGCAGCGGCGGCGAAGAAGATTACTATTGCTCCGATCGTGAGTCCCTCGGCGATGCGCTCGAGAACGAAGACTCTGATTCTCAGTGGGCTCCTCCTAAAGGTCCCTCAGCCAAGGTCATCACAAAAGAATCTCTATTGGCTGCACAGAGGGAAGATTTACGCAGAGTTATGGAATTACTCTCTTTAAGGGAACACCATGCACGTACACTGCTTATACATTATCGTTGGGATGTTGAGAA...

Protein

Download Protein FASTA

605 aa · TkA02G042500|TK1151|PROTEIN

MEEEDCMSSGGEEDYYCSDRESLGDALENEDSDSQWAPPKGPSAKVITKESLLAAQREDLRRVMELLSLREHHARTLLIHYRWDVEKIFAILVEKGKARLFIEAGLPMLESHDLDTSVSTSTTMCEICMEELPFSKKTRMDCGHCFCNDCWTEHFIVKINEGQSRRIRCMAHKCHAICDESIIRTLVGKRHPDLAEKFERFLLESYIEDNKMVKWCPSTPHCGNAIRVEEDEFCEVECSCGNQFCFSCLCEAHSPCSCAM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G042500
TK1151 IDTkA02G042500
OH-1004 IDLXL04_017462
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)96.700
Protein coverage (%)TK1151 99.339 / OH-1004 83.838
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G042500
LocationChr02:10746827-10753008 (-)
DescriptionSimilar to ARI1: Probable E3 ubiquitin-protein ligase ARI1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g34370 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release
At2g16090 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release
At3g27710 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release
At3g27720 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0625800 Acts as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates.
Perception of viral infections and initiation of antiviral defence in rice.2025 · DOI: 10.1038/s41586-025-08706-8
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017462 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006511 ubiquitin-dependent protein catabolic process Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0051607 defense response to virus Biological Process
GO:0080141 regulation of jasmonic acid biosynthetic process Biological Process
GO:0098586 cellular response to virus Biological Process
GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process
GO:0000151 ubiquitin ligase complex Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005654 nucleoplasm Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0008270 zinc ion binding Molecular Function
GO:0031624 ubiquitin conjugating enzyme binding Molecular Function
KEGG gene cross-reference
ath:AT2G16090
ath:AT3G27710
ath:AT3G27720
ath:AT4G34370
dosa:Os03g0625800
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.658
Rank 1 · TkA02G042500 · TK1151
Cytoplasm0.392
Rank 2 · TkA02G042500 · TK1151
Mitochondrion0.049
Rank 3 · TkA02G042500 · TK1151
Cell membrane0.043
Rank 4 · TkA02G042500 · TK1151
Endoplasmic reticulum0.025
Rank 5 · TkA02G042500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21235UBA_ARI155-87 aa
PF26200Rcat_RNF216122-145 aa
PF13923zf-C3HC4_2124-153 aa
PF13639zf-RING_2124-154 aa
PF13445zf-RING_UBOX125-169 aa
PF00097zf-C3HC4125-164 aa
PF01485IBR137-151 aa
PF22191IBR_1141-151 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G042500PF21235UBA_ARI155872.1e-0834.5
TkA02G042500PF26200Rcat_RNF2161221451.9e-0629.1
TkA02G042500PF13923zf-C3HC4_21241530.003717.7
TkA02G042500PF13639zf-RING_21241540.006317.5
TkA02G042500PF13445zf-RING_UBOX1251690.000520.7
TkA02G042500PF00097zf-C3HC41251640.02715.1
TkA02G042500PF01485IBR1371512.1e-1660.4
TkA02G042500PF22191IBR_11411515.9e-0626.8
TkA02G042500PF01485IBR1591802.1e-1660.4
TkA02G042500PF13639zf-RING_21691830.006317.5
TkA02G042500PF13923zf-C3HC4_21741860.003717.7
TkA02G042500PF13445zf-RING_UBOX1751820.000520.7
TkA02G042500PF01485IBR1962582.1e-1660.4
TkA02G042500PF22191IBR_12142515.9e-0626.8
TkA02G042500PF26200Rcat_RNF2162172521.9e-0629.1
TkA02G042500PF13639zf-RING_22342560.006317.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q949V6Arabidopsis thalianasp|Q949V6|ARI1_ARATH Probable E3 ubiquitin-protein ligase ARI165.100%Swiss-ProtHigh
Q84RR2Arabidopsis thalianasp|Q84RR2|ARI2_ARATH Probable E3 ubiquitin-protein ligase ARI266.800%Swiss-ProtHigh
Q9LVX0Arabidopsis thalianasp|Q9LVX0|ARI3_ARATH Probable E3 ubiquitin-protein ligase ARI361.200%Swiss-ProtHigh
Q9LVW9Arabidopsis thalianasp|Q9LVW9|ARI4_ARATH Putative E3 ubiquitin-protein ligase ARI457.800%Swiss-ProtHigh
Q75LV6Oryza sativa subsp. japonicasp|Q75LV6|RG454_ORYSJ Ring-type E3 ubiquitin ligase 45446.900%Swiss-ProtMedium

JBrowse

View in Genome Browser