RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_017462
Reference: OH-1004 Chr: Chr03 Coordinates: 149679606-149686972 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2082 bp · LXL04_017462|LXL04_017462|OH1004|cDNA

ATGGAATCGATCAGATACGACGCTCATATTCTTTCATCCAGGTCGTTTACTTCTTCATCGGTGGTGAGAGGATTTGGTGGTGACAGCAAAGAAGAAATGAGGATTACAATGGTTCCGATTTGTACTTGGTATACAATTATAATCGTGCCCCTTAAGCTTTGCCTCCTCATTGCAAGTAAACCCCCTTTTCCTTCCCATTATTCGCCGGCATTCTCACCTGTTTTCAACTCGATCGTTCCGTTTAACACCTACTCAAATCA...

CDS

Download CDS FASTA

2082 bp · LXL04_017462|LXL04_017462|OH1004|CDS

ATGGAATCGATCAGATACGACGCTCATATTCTTTCATCCAGGTCGTTTACTTCTTCATCGGTGGTGAGAGGATTTGGTGGTGACAGCAAAGAAGAAATGAGGATTACAATGGTTCCGATTTGTACTTGGTATACAATTATAATCGTGCCCCTTAAGCTTTGCCTCCTCATTGCAAGTAAACCCCCTTTTCCTTCCCATTATTCGCCGGCATTCTCACCTGTTTTCAACTCGATCGTTCCGTTTAACACCTACTCAAATCA...

Protein

Download Protein FASTA

693 aa · LXL04_017462|LXL04_017462|OH1004|PROTEIN

MESIRYDAHILSSRSFTSSSVVRGFGGDSKEEMRITMVPICTWYTIIIVPLKLCLLIASKPPFPSHYSPAFSPVFNSIVPFNTYSNHQNPQIDSSIIDYKGLLIKFCTFTPADCMSSGGEEDYYCSDRESLGDALENEDSDSQWAPPKGPSAKVITKESLLAAQREDLRRVMELLSLREHHARTLLIHYRWDVEKIFAILVEKGKARLFIEAGLPMLESHDLDTSVSTSTTMCEICMEELPFSKKTRMDCGHCFCNDCWT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_017462
TK1151 IDTkA02G042500
OH-1004 IDLXL04_017462
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)96.700
Protein coverage (%)TK1151 99.339 / OH-1004 83.838
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_017462
LocationChr03:149679606-149686972 (+)
DescriptionSimilar to ARI1: Probable E3 ubiquitin-protein ligase ARI1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g34370 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release
At2g16090 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release
At3g27710 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release
At3g27720 Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0625800 Acts as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates.
Perception of viral infections and initiation of antiviral defence in rice.2025 · DOI: 10.1038/s41586-025-08706-8
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017462 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006511 ubiquitin-dependent protein catabolic process Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0051607 defense response to virus Biological Process
GO:0080141 regulation of jasmonic acid biosynthetic process Biological Process
GO:0098586 cellular response to virus Biological Process
GO:2000022 regulation of jasmonic acid mediated signaling pathway Biological Process
GO:0000151 ubiquitin ligase complex Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005654 nucleoplasm Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0008270 zinc ion binding Molecular Function
GO:0031624 ubiquitin conjugating enzyme binding Molecular Function
KEGG gene cross-reference
ath:AT2G16090
ath:AT3G27710
ath:AT3G27720
ath:AT4G34370
dosa:Os03g0625800
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.562
Rank 1 · LXL04_017462 · OH-1004
Cytoplasm0.432
Rank 2 · LXL04_017462 · OH-1004
Mitochondrion0.063
Rank 3 · LXL04_017462 · OH-1004
Cell membrane0.061
Rank 4 · LXL04_017462 · OH-1004
Endoplasmic reticulum0.044
Rank 5 · LXL04_017462 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21235.5UBA_ARI1163-195 aa
PF01485.28IBR299-361 aa
PF19422.5Ariadne440-693 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_017462PF21235.5UBA_ARI11631952.6e-0834.2
LXL04_017462PF01485.28IBR2993612.6e-1350.6
LXL04_017462PF19422.5Ariadne4406936.2e-126419.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q949V6Arabidopsis thalianaProbable E3 ubiquitin-protein ligase ARI163.079%Swiss-Protstrong database homology
Q84RR2Arabidopsis thalianaProbable E3 ubiquitin-protein ligase ARI264.725%Swiss-Protstrong database homology
Q9LVX0Arabidopsis thalianaProbable E3 ubiquitin-protein ligase ARI356.863%Swiss-Protstrong database homology
Q9LVW9Arabidopsis thalianaPutative E3 ubiquitin-protein ligase ARI457.396%Swiss-Protmoderate database homology
Q75LV6Oryza sativa subsp. japonicaRing-type E3 ubiquitin ligase 45443.023%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser