Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2291 bp · TkA01G561380|TK1151|cDNA
CTTCTCTCTCCCTTTCTTATCACATACCCACATACGTACCAGATTCATATACGAAACTCGAACGAATAATCTGCCGGAAATCGCTAATTCCTCATTAATTTGAAGTGGTTGCTGGTATGGGTGCATGCGATTGGTTCTAGAATCTTCTTTGATTTTGATACATTATCTGGTGTAAAATAGATATCGGAAAGGAGTTTGATCATGGCCGTTGCTCAAGGGCGCCTAAAAGAGATGCTGCAATCTGCGGTACAATCTGTTCA...
1956 bp · TkA01G561380|TK1151|CDS
ATGGCCGTTGCTCAAGGGCGCCTAAAAGAGATGCTGCAATCTGCGGTACAATCTGTTCAGTGGACGTACATTATTTACTGGCAACTTTGTCCTGAGGAACGGGTTTTAGTATGGGGAGATGGATACTACAATGGCGCAATTAAGACGAGGAAGACGGTGCAGTCAGTGGAAGTTAGCACGGAGGAGGCCGCCTTATGTAGAAGCGAGCAGCTCAGAGAGCTCTACGATTCATTGGCTGCCGGTGATCAGCAGGCGACGGA...
Protein
Download Protein FASTA651 aa · TkA01G561380|TK1151|PROTEIN
MAVAQGRLKEMLQSAVQSVQWTYIIYWQLCPEERVLVWGDGYYNGAIKTRKTVQSVEVSTEEAALCRSEQLRELYDSLAAGDQQATENQQPTVRRPAVALSPEDLTESEWFYLICVSFSFPPGVGLVGEAYAKQQHLWLTGANEAESTIFTRAILAKSADIQTVVCIPLLNGVVEVGTTAKVEEGVDFIQHVKHFFMVGNGISTVLPPRPALSAHSSNTTLSPHQIPPKIKLLDNLYSMNDDEIENEYGDEEDDDEEDEE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G561380 |
|---|---|
| TK1151 ID | TkA01G561380 |
| OH-1004 ID | LXL04_026444 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 29.500 |
| Protein coverage (%) | TK1151 94.931 / OH-1004 97.239Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G561380 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:141170942-141181640 (-) | |||||||||
| Description | Similar to BHLH2: Transcription factor EGL1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0001708 cell fate specification Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009813 flavonoid biosynthetic process Biological Process GO:0009867 jasmonic acid mediated signaling pathway Biological Process GO:0009962 regulation of flavonoid biosynthetic process Biological Process GO:0010026 trichome differentiation Biological Process GO:0010091 trichome branching Biological Process GO:0010214 seed coat development Biological Process GO:0031542 positive regulation of anthocyanin biosynthetic process Biological Process GO:0048316 seed development Biological Process GO:0048629 trichome patterning Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G63650 ath:AT4G00480 ath:AT4G09820 ath:AT5G41315 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF23133DUF70505-48 aaPF14215bHLH-MYC_N8-196 aaPF24914ACR10_N19-31 aaPF23133DUF7050157-196 aaPF14812PBP1_TM240-265 aaPF14215bHLH-MYC_N263-271 aaPF14215bHLH-MYC_N396-404 aaPF00010HLH471-518 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G561380 | PF23133 | DUF7050 | 5 | 48 | 0.0027 | 18.1 |
| TkA01G561380 | PF14215 | bHLH-MYC_N | 8 | 196 | 5.6e-49 | 167.6 |
| TkA01G561380 | PF24914 | ACR10_N | 19 | 31 | 0.18 | 11.9 |
| TkA01G561380 | PF23133 | DUF7050 | 157 | 196 | 0.0027 | 18.1 |
| TkA01G561380 | PF14812 | PBP1_TM | 240 | 265 | 4.3 | 8.4 |
| TkA01G561380 | PF14215 | bHLH-MYC_N | 263 | 271 | 5.6e-49 | 167.6 |
| TkA01G561380 | PF14215 | bHLH-MYC_N | 396 | 404 | 5.6e-49 | 167.6 |
| TkA01G561380 | PF00010 | HLH | 471 | 518 | 9.8e-14 | 51.6 |
| TkA01G561380 | PF23177 | bHLH_IRO3 | 475 | 527 | 9.1e-09 | 36.3 |
| TkA01G561380 | PF23173 | bHLH_SAC51 | 477 | 520 | 0.00056 | 20.5 |
| TkA01G561380 | PF13291 | ACT_4 | 500 | 531 | 0.0029 | 18.9 |
| TkA01G561380 | PF24931 | ACT_ACR9_3rd | 562 | 640 | 0.0001 | 23.0 |
| TkA01G561380 | PF22754 | bHLH-TF_ACT-like_plant | 564 | 644 | 5.5e-17 | 62.3 |
| TkA01G561380 | PF24914 | ACR10_N | 574 | 639 | 0.18 | 11.9 |
| TkA01G561380 | PF13291 | ACT_4 | 576 | 625 | 0.0029 | 18.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.