TkA01G515420 | RubberDandelionOmics

Gene overview

TkA01G515420

Reference: TK1151 Chr: Chr01 Coordinates: 129155222-129157466 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2103 bp · TkA01G515420|TK1151|cDNA

GGAATAATCGATAGAAGTATCGAATCCATAATTGAATTCCAACGTCCCAAGACCTCAAAGAGTACAAGAACTTATTACTACGAAGGCCCAACAGATAAAACCGATCGTGCCGTTCCAGCTCTTAACGGCGTTAAGTTACCCGCAAATGATTTCTCTGTGTGTGAAGTAACAGCTCACCCTCGCCACAGAAAGCAAATGAAACCCCATCAAATCGACGGTTTCAATTTCCTTTTAAGCAATTTGGTGTGCGACAACCCAGG...

CDS

Download CDS FASTA

1824 bp · TkA01G515420|TK1151|CDS

GGAATAATCGATAGAAGTATCGAATCCATAATTGAATTCCAACGTCCCAAGACCTCAAAGAGTACAAGAACTTATTACTACGAAGGCCCAACAGATAAAACCGATCGTGCCGTTCCAGCTCTTAACGGCGTTAAGTTACCCGCAAATGATTTCTCTGTGTGTGAAGTAACAGCTCACCCTCGCCACAGAAAGCAAATGAAACCCCATCAAATCGACGGTTTCAATTTCCTTTTAAGCAATTTGGTGTGCGACAACCCAGG...

Protein

Download Protein FASTA

607 aa · TkA01G515420|TK1151|PROTEIN

GIIDRSIESIIEFQRPKTSKSTRTYYYEGPTDKTDRAVPALNGVKLPANDFSVCEVTAHPRHRKQMKPHQIDGFNFLLSNLVCDNPGGCILAHAPGSGKTFMLISFIQSFMAKYPDARPLVILPRGILGTWKKEFIRWQVEDLPLLDLYSVKAEGRVQQFQVLKQWANKRSILFLGYQQFSSIVCDDDTSTIPVSCQDILLNYPSLVILDEGHTPRNQDTNILTSLEKIQTPRKVVLSGTLYQNHVREVFNILNLVRPKF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G515420`
TK1151 ID	TkA01G515420
OH-1004 ID	LXL04_017516
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	79.700
Protein coverage (%)	TK1151 100.000 / OH-1004 33.959 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G515420

Location Chr01:129155222-129157466 (-)

Description Similar to At4g39110: Probable receptor-like protein kinase At4g39110

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g16390`	Subunit of the chromatin-remodeling complex (DDR complex) that mediates RNA polymerases IV and V (Pol IV and Pol V) recruitment to chromatin.	Atypical RNA polymerase subunits required for RNA-directed DNA methylation.2005 · DOI: 10.1038/ng1580 A SNF2-like protein facilitates dynamic control of DNA methylation.2005 · DOI: 10.1038/sj.embor.7400446 Endogenous targets of RNA-directed DNA methylation and Pol IV in Arabidopsis.2006 · DOI: 10.1038/sj.emboj.7601150 RNAi, DRD1, and histone methylation actively target developmentally important non-CG DNA methylation in arabidopsis.2006 · DOI: 10.1371/journal.pgen.0020083 A structural-maintenance-of-chromosomes hinge domain-containing protein is required for RNA-directed DNA methylation.2008 · DOI: 10.1038/ng.119 Noncoding transcription by RNA polymerase Pol IVb/Pol V mediates transcriptional silencing of overlapping and adjacent genes.2008 · DOI: 10.1016/j.cell.2008.09.035 NRPD4, a protein related to the RPB4 subunit of RNA polymerase II, is a component of RNA polymerases IV and V and is required for RNA-directed DNA methylation.2009 · DOI: 10.1101/gad.1765209 Defining the functional network of epigenetic regulators in Arabidopsis thaliana.2009 · DOI: 10.1093/mp/ssp017 RNA polymerase V functions in Arabidopsis interphase heterochromatin organization independently of the 24-nt siRNA-directed DNA methylation pathway.2009 · DOI: 10.1093/mp/ssp006 The RNA silencing enzyme RNA polymerase v is required for plant immunity.2011 · DOI: 10.1371/journal.pgen.1002434 RNA polymerase V-dependent small RNAs in Arabidopsis originate from small, intergenic loci including most SINE repeats.2012 · DOI: 10.4161/epi.20290 The Arabidopsis nucleosome remodeler DDM1 allows DNA methyltransferases to access H1-containing heterochromatin.2013 · DOI: 10.1016/j.cell.2013.02.033
`At1g05490`	Probable chromatin remodeling factor.	No verified direct reference in this release
`At3g24340`	Probable chromatin remodeling factor.	No verified direct reference in this release
`At3g42670`	Probable chromatin remodeling factor.	Identification of genes required for de novo DNA methylation in Arabidopsis.2011 · DOI: 10.4161/epi.6.3.14242
`At5g20420`	Probable chromatin remodeling factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017516 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006346 DNA methylation-dependent constitutive heterochromatin formation Biological Process

GO:0009555 pollen development Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0035563 positive regulation of chromatin binding Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0051924 regulation of calcium ion transport Biological Process

GO:0070828 heterochromatin organization Biological Process

GO:0071360 cellular response to exogenous dsRNA Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

KEGG gene cross-reference

ath:AT2G16390

ath:AT2G21480

ath:AT4G39110

ath:AT5G54380

ath:AT5G61350

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.808

Rank 1 · TkA01G515420 · TK1151

Cytoplasm0.211

Rank 2 · TkA01G515420 · TK1151

Mitochondrion0.041

Rank 3 · TkA01G515420 · TK1151

Cell membrane0.033

Rank 4 · TkA01G515420 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA01G515420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851ResIII65-241 aa

PF00176SNF2-rel_dom69-369 aa

PF08282Hydrolase_3234-372 aa

PF04851ResIII350-353 aa

PF08282Hydrolase_3389-409 aa

PF00271Helicase_C426-531 aa

PF08282Hydrolase_3453-471 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G515420	`PF04851`	ResIII	65	241	9e-10	39.4
TkA01G515420	`PF00176`	SNF2-rel_dom	69	369	1.4e-26	93.9
TkA01G515420	`PF08282`	Hydrolase_3	234	372	3.6	8.0
TkA01G515420	`PF04851`	ResIII	350	353	9e-10	39.4
TkA01G515420	`PF08282`	Hydrolase_3	389	409	3.6	8.0
TkA01G515420	`PF00271`	Helicase_C	426	531	2.8e-12	47.6
TkA01G515420	`PF08282`	Hydrolase_3	453	471	3.6	8.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIW2`	Arabidopsis thaliana	sp\|Q9SIW2\|CHR35_ARATH Protein CHROMATIN REMODELING 35	62.600%	Swiss-Prot	High
`F4I8S3`	Arabidopsis thaliana	sp\|F4I8S3\|CLSY3_ARATH SNF2 domain-containing protein CLASSY 3	32.900%	Swiss-Prot	Medium
`Q9LK10`	Arabidopsis thaliana	sp\|Q9LK10\|CLSY4_ARATH SNF2 domain-containing protein CLASSY 4	32.600%	Swiss-Prot	Medium
`Q9M297`	Arabidopsis thaliana	sp\|Q9M297\|CLSY1_ARATH SNF2 domain-containing protein CLASSY 1	31.500%	Swiss-Prot	Medium
`F4K493`	Arabidopsis thaliana	sp\|F4K493\|CLSY2_ARATH SNF2 domain-containing protein CLASSY 2	31.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card