TkA01G415460 | RubberDandelionOmics

Gene overview

TkA01G415460

Reference: TK1151 Chr: Chr01 Coordinates: 103679493-103681488 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1367 bp · TkA01G415460|TK1151|cDNA

TGGGGCTGAAAGGAAATTTAAAGAGGTCGTGGAAAACGTAAAACCCAATTTGTTTCTAGAATCGTCGAGTTCTGCAACGAAAAGACACCTCTTGCCGACGATTGCGATTTTGAGATTTCCTCTGTTTGTTTCTGTGGGAGAAGTTGAAAATGGTGGTGCTTGAACCGATGCCTTCGACTGATGACGAACCAAAAAGGTCAAAATCAACGGCCGTTTCCTCAGGGAGCGTAGATTCAAGTAGTGGCGATCAAGCAAACGCT...

CDS

Download CDS FASTA

876 bp · TkA01G415460|TK1151|CDS

ATGGTGGTGCTTGAACCGATGCCTTCGACTGATGACGAACCAAAAAGGTCAAAATCAACGGCCGTTTCCTCAGGGAGCGTAGATTCAAGTAGTGGCGATCAAGCAAACGCTGCCGGGGTAGATAGGAAAAGTGAGGATAGAGTAACCGGCGACGGATACGCATCCGACGGTTTCGAAACCGCAAGCGAAACCGAAGTTGCCGATGATGATACCGTATCTGATGACAATAACAATTCAAAGGACGTCATTGAACATCAACA...

Protein

Download Protein FASTA

291 aa · TkA01G415460|TK1151|PROTEIN

MVVLEPMPSTDDEPKRSKSTAVSSGSVDSSSGDQANAAGVDRKSEDRVTGDGYASDGFETASETEVADDDTVSDDNNNSKDVIEHQQDLTEEVSVASKDQSYEDTLDEDELKQKLLAEMNEAKVEGNKLFGDGLYEEALLKYDYAIQLAPEMPSLAEIRSICHNNRATCFFKLEKYEESIQECTKALELNPNYMKALLRKAEAHEKLENYEDAIAALKKVLELDPSNKQAKRTIIRLEPLAIEKREKMKEEMLGKLKDMG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G415460`
TK1151 ID	TkA01G415460
OH-1004 ID	LXL04_028267
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	70.100
Protein coverage (%)	TK1151 100.000 / OH-1004 94.915 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G415460`
Location	Chr01:103679493-103681488 (+)
Description	Similar to TTC1: Tetratricopeptide repeat protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028267` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:0070098 chemokine-mediated signaling pathway Biological Process GO:0070286 axonemal dynein complex assembly Biological Process GO:0005737 cytoplasm Cellular Component GO:0005778 peroxisomal membrane Cellular Component GO:0005829 cytosol Cellular Component GO:0120293 dynein axonemal particle Cellular Component GO:0030674 protein-macromolecule adaptor activity Molecular Function GO:0051082 unfolded protein binding Molecular Function
KEGG gene cross-reference	bta:504602 hsa:7265 mmu:66827 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.663

Rank 1 · TkA01G415460 · TK1151

Nucleus0.243

Rank 2 · TkA01G415460 · TK1151

Peroxisome0.124

Rank 3 · TkA01G415460 · TK1151

Golgi apparatus0.120

Rank 4 · TkA01G415460 · TK1151

Endoplasmic reticulum0.093

Rank 5 · TkA01G415460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15015NYD-SP12_N77-110 aa

PF19556PRTRC_E84-148 aa

PF29407CFAP70_TPR_C122-229 aa

PF12968DUF3856125-223 aa

PF00515TPR_1126-151 aa

PF07719TPR_2126-151 aa

PF13414TPR_11126-153 aa

PF14559TPR_19129-153 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G415460	`PF15015`	NYD-SP12_N	77	110	0.019	14.1
TkA01G415460	`PF19556`	PRTRC_E	84	148	1.2	9.6
TkA01G415460	`PF29407`	CFAP70_TPR_C	122	229	0.082	13.1
TkA01G415460	`PF12968`	DUF3856	125	223	0.00045	20.9
TkA01G415460	`PF00515`	TPR_1	126	151	3.4e-20	71.7
TkA01G415460	`PF07719`	TPR_2	126	151	2.5e-18	65.3
TkA01G415460	`PF13414`	TPR_11	126	153	2.8e-12	46.8
TkA01G415460	`PF14559`	TPR_19	129	153	1.1e-09	39.2
TkA01G415460	`PF13432`	TPR_16	131	153	1.9e-09	38.5
TkA01G415460	`PF13176`	TPR_7	133	151	0.00068	20.3
TkA01G415460	`PF04212`	MIT	133	148	1.2	10.0
TkA01G415460	`PF13371`	TPR_9	135	192	0.00012	22.8
TkA01G415460	`PF03704`	BTAD	148	227	0.0056	17.8
TkA01G415460	`PF15015`	NYD-SP12_N	155	214	0.019	14.1
TkA01G415460	`PF00515`	TPR_1	162	193	3.4e-20	71.7
TkA01G415460	`PF07719`	TPR_2	162	193	2.5e-18	65.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card