TkA01G321520 | RubberDandelionOmics

Gene overview

TkA01G321520

Reference: TK1151 Chr: Chr01 Coordinates: 79907825-79908871 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

714 bp · TkA01G321520|TK1151|cDNA

ATGCTTCGAGTGCCTGTATTTATCCGAGTTTTTAAGCAGTTGGATACGAACGTGAGCTTGAAGGAATCCGATGCTTGGCCTGCCGAGCCGCAAGATGCTTACGGGCTAGAGAAGTTGGCGACTGAGGAAATATGTAAGCACTACAACAAGGATTTCGGAATTGAGTGTCGTATTGGAAGGTTCCACAACATTTATGGTCCTTTTGGCACATGGAAAGGTGGGAGGGAGAAAGCACCAGCTGCGTTTTGTAGGAAAGCCCT...

CDS

Download CDS FASTA

714 bp · TkA01G321520|TK1151|CDS

ATGCTTCGAGTGCCTGTATTTATCCGAGTTTTTAAGCAGTTGGATACGAACGTGAGCTTGAAGGAATCCGATGCTTGGCCTGCCGAGCCGCAAGATGCTTACGGGCTAGAGAAGTTGGCGACTGAGGAAATATGTAAGCACTACAACAAGGATTTCGGAATTGAGTGTCGTATTGGAAGGTTCCACAACATTTATGGTCCTTTTGGCACATGGAAAGGTGGGAGGGAGAAAGCACCAGCTGCGTTTTGTAGGAAAGCCCT...

Protein

Download Protein FASTA

237 aa · TkA01G321520|TK1151|PROTEIN

MLRVPVFIRVFKQLDTNVSLKESDAWPAEPQDAYGLEKLATEEICKHYNKDFGIECRIGRFHNIYGPFGTWKGGREKAPAAFCRKALTSTDKFEMWGDGLQTRSFTFIDECVEVGHRLTKSDFREPVNIGSDEMVSMNEMAEIVLSFENKKLPITHIPGPEGVRGRNSDNTLIKEKLGWAPSMKLKDGLRITYFWIKEQLEKEKVKGIDLSTYGHRRVVGTQAPVQLGSLRAADGKE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G321520`
TK1151 ID	TkA01G321520
OH-1004 ID	LXL04_022895
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	90.700
Protein coverage (%)	TK1151 95.781 / OH-1004 60.372 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G321520

Location Chr01:79907825-79908871 (-)

Description Similar to OsI_032456: GDP-mannose 3,5-epimerase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g28840`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release
`At3g46440`	Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0591100`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release
`UniProt: A2Z7B3`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release
`Os10g0417600`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022895 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001503 ossification Biological Process

GO:0006024 glycosaminoglycan biosynthetic process Biological Process

GO:0015012 heparan sulfate proteoglycan biosynthetic process Biological Process

GO:0019853 L-ascorbic acid biosynthetic process Biological Process

GO:0030166 proteoglycan biosynthetic process Biological Process

GO:0030198 extracellular matrix organization Biological Process

GO:0033320 UDP-D-xylose biosynthetic process Biological Process

GO:0042732 D-xylose metabolic process Biological Process

GO:0050650 chondroitin sulfate proteoglycan biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT5G28840

dosa:Os10g0417600

dosa:Os11g0591100

dre:192315

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.560

Rank 1 · TkA01G321520 · TK1151

Nucleus0.257

Rank 2 · TkA01G321520 · TK1151

Mitochondrion0.128

Rank 3 · TkA01G321520 · TK1151

Peroxisome0.121

Rank 4 · TkA01G321520 · TK1151

Plastid0.087

Rank 5 · TkA01G321520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01370Epimerase25-130 aa

PF16363GDP_Man_Dehyd25-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G321520	`PF01370`	Epimerase	25	130	1.9e-16	60.9
TkA01G321520	`PF16363`	GDP_Man_Dehyd	25	191	1.2e-15	58.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93VR3`	Arabidopsis thaliana	sp\|Q93VR3\|GME_ARATH GDP-mannose 3,5-epimerase	89.900%	Swiss-Prot	High
`Q9SN95`	Arabidopsis thaliana	sp\|Q9SN95\|UXS5_ARATH UDP-glucuronic acid decarboxylase 5	34.100%	Swiss-Prot	Medium
`Q2R1V8`	Oryza sativa subsp. japonica	sp\|Q2R1V8\|GME2_ORYSJ GDP-mannose 3,5-epimerase 2	91.200%	Swiss-Prot	High
`A2Z7B3`	Oryza sativa subsp. indica	sp\|A2Z7B3\|GME1_ORYSI GDP-mannose 3,5-epimerase 1	88.100%	Swiss-Prot	High
`A3C4S4`	Oryza sativa subsp. japonica	sp\|A3C4S4\|GME1_ORYSJ GDP-mannose 3,5-epimerase 1	88.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card