LXL04_022895 | RubberDandelionOmics

Gene overview

LXL04_022895

Reference: OH-1004 Chr: Chr05 Coordinates: 12616391-12619246 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1131 bp · LXL04_022895|LXL04_022895|OH1004|cDNA

ATGGGAGAAAACGGCGAAACAAAATACGGGTCGTTCACATACGAAAGCCTGGAACGAGAACCATACTGGCCAACGGAAAAGCTGCGAGTGTCCATCACCGGAGCCGGTGGGTTCATAGCTTCACACATTGCCCGCCGATTGAAAACAGAAGGCCATTACATCATCGCTTCTGATTGGAAGAAAAACGAGCACATGTCTGAAGACATGTTCTGCCATGAGTTCCATCTTGTTGATCTTCGGGTCATGGATAACTGCTTGAA...

CDS

Download CDS FASTA

1131 bp · LXL04_022895|LXL04_022895|OH1004|CDS

ATGGGAGAAAACGGCGAAACAAAATACGGGTCGTTCACATACGAAAGCCTGGAACGAGAACCATACTGGCCAACGGAAAAGCTGCGAGTGTCCATCACCGGAGCCGGTGGGTTCATAGCTTCACACATTGCCCGCCGATTGAAAACAGAAGGCCATTACATCATCGCTTCTGATTGGAAGAAAAACGAGCACATGTCTGAAGACATGTTCTGCCATGAGTTCCATCTTGTTGATCTTCGGGTCATGGATAACTGCTTGAA...

Protein

Download Protein FASTA

376 aa · LXL04_022895|LXL04_022895|OH1004|PROTEIN

MGENGETKYGSFTYESLEREPYWPTEKLRVSITGAGGFIASHIARRLKTEGHYIIASDWKKNEHMSEDMFCHEFHLVDLRVMDNCLKVTEKVDHVFNLAADMGGMGFIQSNHSVIMYNNTMISFNMLEAARITGVKRFFYASSACIYPEFKQLETNVSLKESDAWPAEPQDAYGLEKLATEELCRHYTKDFGIECRIGRFHNIYGPFGTWKGGREKAPAAFCRKALTATDKFEMWGDGLQTRSFTFIDECVEGVLRLTKS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022895`
TK1151 ID	TkA01G321520
OH-1004 ID	LXL04_022895
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	90.700
Protein coverage (%)	TK1151 95.781 / OH-1004 60.372 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022895

Location Chr05:12616391-12619246 (+)

Description Similar to OsI_032456: GDP-mannose 3,5-epimerase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g28840`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2Z7B3`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release
`Os10g0417600`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release
`Os11g0591100`	Catalyzes a reversible epimerization of GDP-D-mannose that precedes the committed step in the biosynthesis of vitamin C (L-ascorbate), resulting in the hydrolysis of the highly energetic glycosyl-pyrophosphoryl linkage.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022895 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001503 ossification Biological Process

GO:0006024 glycosaminoglycan biosynthetic process Biological Process

GO:0015012 heparan sulfate proteoglycan biosynthetic process Biological Process

GO:0019853 L-ascorbic acid biosynthetic process Biological Process

GO:0030166 proteoglycan biosynthetic process Biological Process

GO:0030198 extracellular matrix organization Biological Process

GO:0033320 UDP-D-xylose biosynthetic process Biological Process

GO:0042732 D-xylose metabolic process Biological Process

GO:0050650 chondroitin sulfate proteoglycan biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

KEGG gene cross-reference

ath:AT5G28840

dosa:Os10g0417600

dosa:Os11g0591100

dre:192315

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.660

Rank 1 · LXL04_022895 · OH-1004

Nucleus0.316

Rank 2 · LXL04_022895 · OH-1004

Mitochondrion0.086

Rank 3 · LXL04_022895 · OH-1004

Plastid0.074

Rank 4 · LXL04_022895 · OH-1004

Cell membrane0.064

Rank 5 · LXL04_022895 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01370.28Epimerase31-269 aa

PF16363.12GDP_Man_Dehyd32-330 aa

PF01073.263Beta_HSD32-183 aa

PF07993.19NAD_binding_487-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022895	`PF01370.28`	Epimerase	31	269	7.7e-46	157.2
LXL04_022895	`PF16363.12`	GDP_Man_Dehyd	32	330	1.3e-28	101.2
LXL04_022895	`PF01073.26`	3Beta_HSD	32	183	2e-09	37.6
LXL04_022895	`PF07993.19`	NAD_binding_4	87	205	3.3e-07	30.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93VR3`	Arabidopsis thaliana	GDP-mannose 3,5-epimerase	88.859%	Swiss-Prot	strong database homology
`A2Z7B3`	Oryza sativa subsp. indica	GDP-mannose 3,5-epimerase 1	90.107%	Swiss-Prot	strong database homology
`A3C4S4`	Oryza sativa subsp. japonica	GDP-mannose 3,5-epimerase 1	90.107%	Swiss-Prot	strong database homology
`Q2R1V8`	Oryza sativa subsp. japonica	GDP-mannose 3,5-epimerase 2	92.055%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card