Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1021 bp · TkA01G070520|TK1151|cDNA
ATCGACTGCAATAACAAACTTAGAAGCCAACACTACTAGCTATGAGCTCTAACCGTGGTTCAGGAAGTCGAAATCTTCGAAGAAACGCTTTGGAGTTTGGAAGGACTTTTGTGGTGATGCCTAAAGGAATTCACAAAGCTACTATAGTATGGTTACATGGCATTGGGGAGAAGGGTTCAAGCTGGACTCAAATCTTGGAAACTCTGCCACTTCCCAATATCAAATGGATCTGCCCGAGTGCGCCAATTCGTCAAGTAGCT...
753 bp · TkA01G070520|TK1151|CDS
ATGAGCTCTAACCGTGGTTCAGGAAGTCGAAATCTTCGAAGAAACGCTTTGGAGTTTGGAAGGACTTTTGTGGTGATGCCTAAAGGAATTCACAAAGCTACTATAGTATGGTTACATGGCATTGGGGAGAAGGGTTCAAGCTGGACTCAAATCTTGGAAACTCTGCCACTTCCCAATATCAAATGGATCTGCCCGAGTGCGCCAATTCGTCAAGTAGCTCTATTTGGTGGATATCCCTGCACTGCTTGGTTTAATATGGA...
Protein
Download Protein FASTA250 aa · TkA01G070520|TK1151|PROTEIN
MSSNRGSGSRNLRRNALEFGRTFVVMPKGIHKATIVWLHGIGEKGSSWTQILETLPLPNIKWICPSAPIRQVALFGGYPCTAWFNMESMSEDACDDLEGLDASATHVANLLISEPDDVKVGVAGFSMGAAVALYSATCRALGQYGNGNRYPINLSAAVALSGWLPCSRNLRNRVGASQEAARRASSLPILLCHGKVDDVVEYKLGEKSAQTMYSSGFQSVAFRAYNGLGHYTSLEEINDVASWLIACLGA
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA01G070520 |
|---|---|
| TK1151 ID | TkA01G070520 |
| OH-1004 ID | LXL04_015570 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 70.700 |
| Protein coverage (%) | TK1151 98.800 / OH-1004 95.926Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA01G070520 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr01:18029048-18032748 (-) | ||||||||||||
| Description | Similar to DDB_G0282005: Acyl-protein thioesterase 1 homolog 1 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0002084 protein depalmitoylation Biological Process GO:0006631 fatty acid metabolic process Biological Process GO:0046464 acylglycerol catabolic process Biological Process GO:1905344 prostaglandin catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005795 Golgi stack Cellular Component GO:0005829 cytosol Cellular Component GO:0070062 extracellular exosome Cellular Component GO:0004622 phosphatidylcholine lysophospholipase A1 activity Molecular Function GO:0008474 palmitoyl-(protein) hydrolase activity Molecular Function | ||||||||||||
| KEGG gene cross-reference | cnb:CNBF2260 ddi:DDB_G0282005 hsa:11313 mmu:26394 rno:83510 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02230Abhydrolase_222-246 aaPF12146Hydrolase_431-58 aaPF00561Abhydrolase_134-56 aaPF12697Abhydrolase_635-172 aaPF03959FSH179-212 aaPF01738DLH107-230 aaPF01764Lipase_3107-137 aaPF12146Hydrolase_4111-136 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA01G070520 | PF02230 | Abhydrolase_2 | 22 | 246 | 8.9e-35 | 121.2 |
| TkA01G070520 | PF12146 | Hydrolase_4 | 31 | 58 | 6.2e-06 | 26.4 |
| TkA01G070520 | PF00561 | Abhydrolase_1 | 34 | 56 | 0.17 | 12.2 |
| TkA01G070520 | PF12697 | Abhydrolase_6 | 35 | 172 | 9.7e-05 | 23.8 |
| TkA01G070520 | PF03959 | FSH1 | 79 | 212 | 3e-08 | 34.3 |
| TkA01G070520 | PF01738 | DLH | 107 | 230 | 0.0013 | 19.1 |
| TkA01G070520 | PF01764 | Lipase_3 | 107 | 137 | 0.062 | 13.9 |
| TkA01G070520 | PF12146 | Hydrolase_4 | 111 | 136 | 6.2e-06 | 26.4 |
| TkA01G070520 | PF03583 | LIP | 115 | 137 | 0.0048 | 17.0 |
| TkA01G070520 | PF00326 | Peptidase_S9 | 116 | 137 | 0.00061 | 20.1 |
| TkA01G070520 | PF20434 | BD-FAE | 116 | 140 | 0.3 | 11.3 |
| TkA01G070520 | PF00561 | Abhydrolase_1 | 118 | 134 | 0.17 | 12.2 |
| TkA01G070520 | PF00756 | Esterase | 119 | 210 | 0.14 | 12.6 |
| TkA01G070520 | PF00561 | Abhydrolase_1 | 143 | 236 | 0.17 | 12.2 |
| TkA01G070520 | PF12146 | Hydrolase_4 | 177 | 235 | 6.2e-06 | 26.4 |
| TkA01G070520 | PF00326 | Peptidase_S9 | 178 | 249 | 0.00061 | 20.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.