TkA01G019990 | RubberDandelionOmics

Gene overview

TkA01G019990

Reference: TK1151 Chr: Chr01 Coordinates: 5133828-5140536 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2496 bp · TkA01G019990|TK1151|cDNA

TTAGGCCCACAACTGCACAAGGAGAGAGGGCGCCATAGCAACCCAGCCACTACGAAAGGGTTTACCATTCGTGTTATTTATCGTCTTCCATTATCTGCCGGAATTTCACTTGCCGGAAACCGTACTGTGAATTAGGTTGACGGCGAATATGACCGAAGTAGCTAGCAACGTTGTTCACGAAGTATTAGGTCCAAGAGCACAAGAGCTTGATCAGCCAATCATTGATTACATAATTAATGTCCTCGCGGATGAAGATTTCG...

CDS

Download CDS FASTA

2139 bp · TkA01G019990|TK1151|CDS

ATGACCGAAGTAGCTAGCAACGTTGTTCACGAAGTATTAGGTCCAAGAGCACAAGAGCTTGATCAGCCAATCATTGATTACATAATTAATGTCCTCGCGGATGAAGATTTCGATTTCGGATTTGAAGGCGAAGGCGCCTTTGATGCCATTGGAGAACTTCTCGTTGATTCCGGCTGTGTTACCGACTTTGATGAGTGTCAATCTATTTGTGGCAGACTATCTGAGAAATTCGGAAAGCATGGTTTGATCAAAATAAAGCC...

Protein

Download Protein FASTA

712 aa · TkA01G019990|TK1151|PROTEIN

MTEVASNVVHEVLGPRAQELDQPIIDYIINVLADEDFDFGFEGEGAFDAIGELLVDSGCVTDFDECQSICGRLSEKFGKHGLIKIKPAVRSLATPFRMNEGMDEEKAPKRKPEPVDGPLLTERDKIKLERRKRKDERQREVQYQMHVAEMEAAKAGMPVVSVNHDNTVEGPSVRDIHMENFNVSVGGRELIVDCTVTLSHGRHYGLVGRNGTGKTTFLRYMAMHAIEGIPKNCQILHVEQEVVGDDTSALQCVLNSDVER...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G019990`
TK1151 ID	TkA01G019990
OH-1004 ID	LXL04_005732
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G019990

Location Chr01:5133828-5140536 (+)

Description Similar to ABCF3: ABC transporter F family member 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64550`	ABC transporter F family member 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005732 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042742 defense response to bacterium Biological Process

GO:0051607 defense response to virus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016020 membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0045296 cadherin binding Molecular Function

KEGG gene cross-reference

ath:AT1G64550

hsa:55324

mmu:27406

pon:100172759

rno:287982

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.636

Rank 1 · TkA01G019990 · TK1151

Nucleus0.534

Rank 2 · TkA01G019990 · TK1151

Mitochondrion0.042

Rank 3 · TkA01G019990 · TK1151

Cell membrane0.038

Rank 4 · TkA01G019990 · TK1151

Endoplasmic reticulum0.031

Rank 5 · TkA01G019990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26051PWI_ABCF38-79 aa

PF13238AAA_1869-117 aa

PF13671AAA_33130-160 aa

PF03193RsgA_GTPase178-222 aa

PF00006ATP-synt_ab191-225 aa

PF00005ABC_tran194-366 aa

PF12775AAA_7197-227 aa

PF13604AAA_30199-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G019990	`PF26051`	PWI_ABCF3	8	79	4.9e-16	59.0
TkA01G019990	`PF13238`	AAA_18	69	117	0.0048	18.1
TkA01G019990	`PF13671`	AAA_33	130	160	0.038	15.0
TkA01G019990	`PF03193`	RsgA_GTPase	178	222	0.0037	17.8
TkA01G019990	`PF00006`	ATP-synt_ab	191	225	0.028	14.8
TkA01G019990	`PF00005`	ABC_tran	194	366	1e-42	146.7
TkA01G019990	`PF12775`	AAA_7	197	227	0.021	15.1
TkA01G019990	`PF13604`	AAA_30	199	224	0.0059	17.1
TkA01G019990	`PF24389`	ORC-CDC6-like	200	228	1.3e-05	24.9
TkA01G019990	`PF01935`	DUF87	201	227	0.024	15.4
TkA01G019990	`PF02463`	SMC_N	202	400	3.2e-09	37.3
TkA01G019990	`PF13401`	AAA_22	202	277	0.00024	22.2
TkA01G019990	`PF13555`	AAA_29	203	218	9.1e-05	22.9
TkA01G019990	`PF13191`	AAA_16	203	271	0.0034	18.6
TkA01G019990	`PF13479`	AAA_24	203	221	0.0042	17.5
TkA01G019990	`PF13245`	AAA_19	203	227	0.19	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H0V6`	Arabidopsis thaliana	sp\|Q8H0V6\|AB3F_ARATH ABC transporter F family member 3	82.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card