LXL04_005732 | RubberDandelionOmics

Gene overview

LXL04_005732

Reference: OH-1004 Chr: Chr01 Coordinates: 172369704-172376542 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2139 bp · LXL04_005732|LXL04_005732|OH1004|cDNA

ATGACCGAAGTAGCTAGCAACGTTGTTCACGAAGTATTAGGTCCAAGAGCACAAGAGCTTGATCAGCCAATCATTGATTACATAATTAATGTCCTCGCGGATGAAGATTTCGATTTCGGATTTGAAGGCGAAGGCGCCTTTGATGCCATTGGAGAACTTCTCGTTGATTCCGGCTGTGTTACCGACTTTGATGAGTGTCAATCTATTTGTGGCAGACTATCTGAGAAATTCGGAAAGCATGGTTTGATCAAAATAAAGCC...

CDS

Download CDS FASTA

2139 bp · LXL04_005732|LXL04_005732|OH1004|CDS

ATGACCGAAGTAGCTAGCAACGTTGTTCACGAAGTATTAGGTCCAAGAGCACAAGAGCTTGATCAGCCAATCATTGATTACATAATTAATGTCCTCGCGGATGAAGATTTCGATTTCGGATTTGAAGGCGAAGGCGCCTTTGATGCCATTGGAGAACTTCTCGTTGATTCCGGCTGTGTTACCGACTTTGATGAGTGTCAATCTATTTGTGGCAGACTATCTGAGAAATTCGGAAAGCATGGTTTGATCAAAATAAAGCC...

Protein

Download Protein FASTA

712 aa · LXL04_005732|LXL04_005732|OH1004|PROTEIN

MTEVASNVVHEVLGPRAQELDQPIIDYIINVLADEDFDFGFEGEGAFDAIGELLVDSGCVTDFDECQSICGRLSEKFGKHGLIKIKPAVRSLATPFRMNEGMDEEKAPKRKPEPVDGPLLTERDKIKLERRKRKDERQREVQYQMHVAEMEAAKAGMPVVSVNHDNTVEGPSVRDIHMENFNVSVGGRELIVDCTVTLSHGRHYGLVGRNGTGKTTFLRYMAMHAIEGIPKNCQILHVEQEVVGDDTSALQCVLNSDVER...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_005732`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_005732

Location Chr01:172369704-172376542 (-)

Description Similar to ABCF3: ABC transporter F family member 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g64550`	ABC transporter F family member 3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005732 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0042742 defense response to bacterium Biological Process

GO:0051607 defense response to virus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016020 membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0045296 cadherin binding Molecular Function

KEGG gene cross-reference

ath:AT1G64550

hsa:55324

mmu:27406

pon:100172759

rno:287982

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.636

Rank 1 · LXL04_005732 · OH-1004

Nucleus0.534

Rank 2 · LXL04_005732 · OH-1004

Mitochondrion0.042

Rank 3 · LXL04_005732 · OH-1004

Cell membrane0.038

Rank 4 · LXL04_005732 · OH-1004

Endoplasmic reticulum0.031

Rank 5 · LXL04_005732 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26051.1PWI_ABCF38-79 aa

PF00005.34ABC_tran194-366 aa

PF12848.14ABC_tran_Xtn407-485 aa

PF00005.34ABC_tran519-649 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_005732	`PF26051.1`	PWI_ABCF3	8	79	4.9e-16	59.0
LXL04_005732	`PF00005.34`	ABC_tran	194	366	1e-42	146.7
LXL04_005732	`PF12848.14`	ABC_tran_Xtn	407	485	3.8e-23	82.1
LXL04_005732	`PF00005.34`	ABC_tran	519	649	1e-42	146.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H0V6`	Arabidopsis thaliana	ABC transporter F family member 3	81.958%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card