LXL04_037429 | RubberDandelionOmics

Gene overview

LXL04_037429

Reference: OH-1004 Chr: Chr09 Coordinates: 10896330-10903677 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3069 bp · LXL04_037429|LXL04_037429|OH1004|cDNA

ATGAGGTTTCACCTCTCTCGTAATTTGAATCTAGCGTTGGATTACCGTCGTGTCGTCGCTTGTTCAGCTGCATCTAATTTATCACTCCGGGCGGCGGCGGCGGATTATTCTCCTCGTAGGAAGGATTACATATCTGCTTTAGGAAGTTTTAATTTGTCAACTGTTGCTTCGGTGCGAGACTCTTCCTTTACGAAGACCATGGGCTCGCAATCGGCAGCGGAGGTGGAGTGGCCAGCCAACAAAGTTAGAGATACTTTCAT...

CDS

Download CDS FASTA

3069 bp · LXL04_037429|LXL04_037429|OH1004|CDS

ATGAGGTTTCACCTCTCTCGTAATTTGAATCTAGCGTTGGATTACCGTCGTGTCGTCGCTTGTTCAGCTGCATCTAATTTATCACTCCGGGCGGCGGCGGCGGATTATTCTCCTCGTAGGAAGGATTACATATCTGCTTTAGGAAGTTTTAATTTGTCAACTGTTGCTTCGGTGCGAGACTCTTCCTTTACGAAGACCATGGGCTCGCAATCGGCAGCGGAGGTGGAGTGGCCAGCCAACAAAGTTAGAGATACTTTCAT...

Protein

Download Protein FASTA

1022 aa · LXL04_037429|LXL04_037429|OH1004|PROTEIN

MRFHLSRNLNLALDYRRVVACSAASNLSLRAAAADYSPRRKDYISALGSFNLSTVASVRDSSFTKTMGSQSAAEVEWPANKVRDTFIKFFEERNHVYWKSSPVVPVNDPTLLFANAGMNQYKPIFLGTADPNTSLSKLTRACNTQKCIRAGGKHNDLDDVGKDTYHHTFFEMLGNWSFGDYFKEEAIGWAWELLTTLPTDRIYATYFGGDEKLGLPADNEAREIWLKYLPPARVLPFGCKDNFWEMGDTGPCGPCTEIHF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037429`
TK1151 ID	TkA04G307610
OH-1004 ID	LXL04_037429
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.500
Protein coverage (%)	TK1151 100.000 / OH-1004 99.609 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037429

Location Chr09:10896330-10903677 (-)

Description Similar to ALATS: Alanine--tRNA ligase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50200`	Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction: alanine is first activated by ATP to form Ala-AMP and then transferred to the acceptor end of tRNA(Ala).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037429 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006400 tRNA modification Biological Process

GO:0006418 tRNA aminoacylation for protein translation Biological Process

GO:0006419 alanyl-tRNA aminoacylation Biological Process

GO:0008033 tRNA processing Biological Process

GO:0035332 positive regulation of hippo signaling Biological Process

GO:0070143 mitochondrial alanyl-tRNA aminoacylation Biological Process

GO:0140018 regulation of cytoplasmic translational fidelity Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G50200

cal:CAALFM_C603720WA

ddi:DDB_G0277823

hsa:16

sce:YOR335C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.475

Rank 1 · LXL04_037429 · OH-1004

Cytoplasm0.243

Rank 2 · LXL04_037429 · OH-1004

Plastid0.227

Rank 3 · LXL04_037429 · OH-1004

Peroxisome0.124

Rank 4 · LXL04_037429 · OH-1004

Nucleus0.066

Rank 5 · LXL04_037429 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01411.25tRNA-synt_2c81-653 aa

PF07973.20tRNA_SAD751-809 aa

PF26023.1ALA1817-879 aa

PF02272.25DHHA1917-1013 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037429	`PF01411.25`	tRNA-synt_2c	81	653	3.9e-213	709.7
LXL04_037429	`PF07973.20`	tRNA_SAD	751	809	2.3e-13	50.6
LXL04_037429	`PF26023.1`	ALA1	817	879	6.4e-06	27.2
LXL04_037429	`PF02272.25`	DHHA1	917	1013	1.3e-12	48.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P36428`	Arabidopsis thaliana	Alanine--tRNA ligase	72.432%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card