LXL04_030867 | RubberDandelionOmics

Gene overview

LXL04_030867

Reference: OH-1004 Chr: Chr06 Coordinates: 124293718-124294801 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

627 bp · LXL04_030867|LXL04_030867|OH1004|cDNA

ATGGAGGTTTTCGAAGTTGATGAGCCGGAGCATCTACTGTTATTAAGAGAACACGAACATGACGAATTTAATCGATCAGAAGCTAAAATTGAAGTGAAGAATCTATCGCGATGTCCGAGCGGTAGCGGTAAGTCTACGCTTGTAAGAGCACTCAATCGGCTATGGGAGCCAGCTTCGGGCACGGTGTTTCTCGACGGAAAAGATATCACCGGCCTCGATGTTCTTCAGCTCCGGCGAAAAGTCGGTATGCTGTTTCAGCT...

CDS

Download CDS FASTA

627 bp · LXL04_030867|LXL04_030867|OH1004|CDS

ATGGAGGTTTTCGAAGTTGATGAGCCGGAGCATCTACTGTTATTAAGAGAACACGAACATGACGAATTTAATCGATCAGAAGCTAAAATTGAAGTGAAGAATCTATCGCGATGTCCGAGCGGTAGCGGTAAGTCTACGCTTGTAAGAGCACTCAATCGGCTATGGGAGCCAGCTTCGGGCACGGTGTTTCTCGACGGAAAAGATATCACCGGCCTCGATGTTCTTCAGCTCCGGCGAAAAGTCGGTATGCTGTTTCAGCT...

Protein

Download Protein FASTA

208 aa · LXL04_030867|LXL04_030867|OH1004|PROTEIN

MEVFEVDEPEHLLLLREHEHDEFNRSEAKIEVKNLSRCPSGSGKSTLVRALNRLWEPASGTVFLDGKDITGLDVLQLRRKVGMLFQLPVLFEGTVADNIRYGPRELSVGQAQRVALARTLANDPEVLLLDEPTSALDPVSTQNIEDLLMKLKSKGMTIVIVSHSIKQIQKIADVVCLVVGGEIVEVLNLEQLSEAKHPMARRFLELGS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030867`
TK1151 ID	TkA07G437630
OH-1004 ID	LXL04_030867
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	75.000
Protein coverage (%)	TK1151 100.000 / OH-1004 60.577 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030867

Location Chr06:124293718-124294801 (-)

Description Similar to ABCI17: ABC transporter I family member 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67940`	ABC transporter I family member 17.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0695800`	Associates with STAR2 to form a functional transmembrane ABC transporter required for detoxification of aluminum (Al) in roots.	A bacterial-type ABC transporter is involved in aluminum tolerance in rice.2009 · DOI: 10.1105/tpc.108.064543

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030867 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010044 response to aluminum ion Biological Process

GO:0015786 UDP-glucose transmembrane transport Biological Process

GO:0035435 phosphate ion transmembrane transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0012506 vesicle membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

GO:0005460 UDP-glucose transmembrane transporter activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0015415 ATPase-coupled phosphate ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

afu:AF_1359

ath:AT1G67940

dosa:Os06g0695800

tte:TTE0320

tte:TTE1628

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.665

Rank 1 · LXL04_030867 · OH-1004

Nucleus0.321

Rank 2 · LXL04_030867 · OH-1004

Peroxisome0.097

Rank 3 · LXL04_030867 · OH-1004

Mitochondrion0.073

Rank 4 · LXL04_030867 · OH-1004

Cell membrane0.044

Rank 5 · LXL04_030867 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00005.34ABC_tran39-98 aa

PF00005.34ABC_tran97-134 aa

PF13304.13AAA_21115-164 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030867	`PF00005.34`	ABC_tran	39	98	2.7e-23	83.8
LXL04_030867	`PF00005.34`	ABC_tran	97	134	2.7e-23	83.8
LXL04_030867	`PF13304.13`	AAA_21	115	164	1.3e-08	35.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9W0`	Arabidopsis thaliana	ABC transporter I family member 17	57.769%	Swiss-Prot	strong database homology
`Q0D9V6`	Oryza sativa subsp. japonica	Protein STAR1	67.337%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card