TkA07G437630 | RubberDandelionOmics

Gene overview

TkA07G437630

Reference: TK1151 Chr: Chr07 Coordinates: 110790474-110795027 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1112 bp · TkA07G437630|TK1151|cDNA

TAAACTTCATCAGCATTCTGTAATTCTCCTAAACGCCTTACATGTTTTCCGCTAATTTGGACCCTACGATCGTGTTTTGATTTCAACATTTCAAACAGATTCTGCGCGGGGAACATTTACTATCAGTAAACGAAAAACGAAAACGGAAACGGTGGATTTCATGGATCAGAAAAAAGCAAGATTCAGGTGAAGAATTTGACGAGATTTTTAGATAAAGGAGTTTCGATCCTTCAAAATGTGAGTCTGGAGATACCTAGAGG...

CDS

Download CDS FASTA

471 bp · TkA07G437630|TK1151|CDS

ATGCTGTTTCAGCTTCCAGTTTTGTTCGAAGGTACAGTTGCAGACAACATAAGATACGGGCCACAATTACAAGGAAAGAAACTAAGCGATGAACAAGTCTACAAGTTATTGACTTTTGCTGATCTCGACTCCTCTTTCTTCCATAAACATGGGAGCGAACTATCGGTAGGTCAAGCTCAAAGAGTTGCACTTGCTAGAACATTAGCAAACGACCCCGAGGTTTTGTTGTTAGATGAGCCGACAAGTGCATTGGATCCGGT...

Protein

Download Protein FASTA

156 aa · TkA07G437630|TK1151|PROTEIN

MLFQLPVLFEGTVADNIRYGPQLQGKKLSDEQVYKLLTFADLDSSFFHKHGSELSVGQAQRVALARTLANDPEVLLLDEPTSALDPVSTENIEDLLVKLKSKGMTIAIVSHSIKQIQKIADVVCVVVGGEIVEVLMSEELSEAKHPMAKRFLELGS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G437630`
TK1151 ID	TkA07G437630
OH-1004 ID	LXL04_030867
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	75.000
Protein coverage (%)	TK1151 100.000 / OH-1004 60.577 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G437630

Location Chr07:110790474-110795027 (-)

Description Similar to ABCI17: ABC transporter I family member 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67940`	ABC transporter I family member 17.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0695800`	Associates with STAR2 to form a functional transmembrane ABC transporter required for detoxification of aluminum (Al) in roots.	A bacterial-type ABC transporter is involved in aluminum tolerance in rice.2009 · DOI: 10.1105/tpc.108.064543

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030867 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010044 response to aluminum ion Biological Process

GO:0015786 UDP-glucose transmembrane transport Biological Process

GO:0035435 phosphate ion transmembrane transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0012506 vesicle membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0005315 phosphate transmembrane transporter activity Molecular Function

GO:0005460 UDP-glucose transmembrane transporter activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0015415 ATPase-coupled phosphate ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

afu:AF_1359

ath:AT1G67940

dosa:Os06g0695800

tte:TTE0320

tte:TTE1628

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.752

Rank 1 · TkA07G437630 · TK1151

Nucleus0.385

Rank 2 · TkA07G437630 · TK1151

Peroxisome0.054

Rank 3 · TkA07G437630 · TK1151

Mitochondrion0.054

Rank 4 · TkA07G437630 · TK1151

Cell membrane0.030

Rank 5 · TkA07G437630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00005ABC_tran1-82 aa

PF02463SMC_N22-125 aa

PF09818ABC_ATPase59-130 aa

PF13304AAA_2163-112 aa

PF21270SOGP_4th83-133 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G437630	`PF00005`	ABC_tran	1	82	1.1e-12	49.5
TkA07G437630	`PF02463`	SMC_N	22	125	0.0036	17.5
TkA07G437630	`PF09818`	ABC_ATPase	59	130	0.036	13.8
TkA07G437630	`PF13304`	AAA_21	63	112	0.0004	21.1
TkA07G437630	`PF21270`	SOGP_4th	83	133	0.045	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9W0`	Arabidopsis thaliana	sp\|Q9C9W0\|AB17I_ARATH ABC transporter I family member 17	77.700%	Swiss-Prot	High
`Q0D9V6`	Oryza sativa subsp. japonica	sp\|Q0D9V6\|STAR1_ORYSJ Protein STAR1	72.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card