LXL04_027627 | RubberDandelionOmics

Gene overview

LXL04_027627

Reference: OH-1004 Chr: Chr06 Coordinates: 20646974-20649228 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1239 bp · LXL04_027627|LXL04_027627|OH1004|cDNA

ATGCAAATGCTAAACTTTACCAAGTCAAGAACTCGGTCAAACAGACCTGGTTCTTTAGGAGGCATGGATTTTATAGATCCAGTGAAGAAAAGTGGTGTTGTAAGAAAGATTATATTTGCTACAAGTCTTGTAGCTTTATGCATCACAATGATCAAATTATCCCCATCTTTCAGCAGCCCTAGCCCTTTCTCTCGTCATGAAACAGGGATTACTCACGTGTTAGTAACAGGAGGAGCTGGTTTTATTGGCTCACATGCTTC...

CDS

Download CDS FASTA

1239 bp · LXL04_027627|LXL04_027627|OH1004|CDS

ATGCAAATGCTAAACTTTACCAAGTCAAGAACTCGGTCAAACAGACCTGGTTCTTTAGGAGGCATGGATTTTATAGATCCAGTGAAGAAAAGTGGTGTTGTAAGAAAGATTATATTTGCTACAAGTCTTGTAGCTTTATGCATCACAATGATCAAATTATCCCCATCTTTCAGCAGCCCTAGCCCTTTCTCTCGTCATGAAACAGGGATTACTCACGTGTTAGTAACAGGAGGAGCTGGTTTTATTGGCTCACATGCTTC...

Protein

Download Protein FASTA

412 aa · LXL04_027627|LXL04_027627|OH1004|PROTEIN

MQMLNFTKSRTRSNRPGSLGGMDFIDPVKKSGVVRKIIFATSLVALCITMIKLSPSFSSPSPFSRHETGITHVLVTGGAGFIGSHASLRLLKDSHRVTIVDNLSRGNLGAIKVLQSLFPEPGRLQFIYADLGDPKAVNKIFSENAFDAVMHFAAVAYVGESTLDPLKYYHNITSNTLVVLETMAAHNVNTLIYSSTCATYGEPDKMPITEETPQHPINPYGKAKKMAEDIILDFHKNSDMAVMILRYFNVIGSDPDGRLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027627`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027627

Location Chr06:20646974-20649228 (-)

Description Similar to MUR4: UDP-arabinose 4-epimerase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30620`	Acts as a UDP-D-xylose 4-epimerase but lacks both UDP-D- glucose and UDP-D-glucuronic acid 4-epimerase activities in vitro.	The biosynthesis of L-arabinose in plants: molecular cloning and characterization of a Golgi-localized UDP-D-xylose 4-epimerase encoded by the MUR4 gene of Arabidopsis.2003 · DOI: 10.1105/tpc.008425
`At4g20460`	Probable UDP-arabinose 4-epimerase 3.	No verified direct reference in this release
`At2g34850`	Putative UDP-arabinose 4-epimerase 2.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0618200`	Probable UDP-arabinose 4-epimerase 2.	No verified direct reference in this release
`Os07g0139400`	Probable UDP-arabinose 4-epimerase 1.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027627 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006012 galactose metabolic process Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0019567 arabinose biosynthetic process Biological Process

GO:0033358 UDP-L-arabinose biosynthetic process Biological Process

GO:0045227 capsule polysaccharide biosynthetic process Biological Process

GO:0048868 pollen tube development Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0032580 Golgi cisterna membrane Cellular Component

GO:0003978 UDP-glucose 4-epimerase activity Molecular Function

GO:0050373 UDP-arabinose 4-epimerase activity Molecular Function

KEGG gene cross-reference

ath:AT1G30620

ath:AT2G34850

ath:AT4G20460

dosa:Os07g0139400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.473

Rank 1 · LXL04_027627 · OH-1004

Endoplasmic reticulum0.211

Rank 2 · LXL04_027627 · OH-1004

Lysosome / Vacuole0.154

Rank 3 · LXL04_027627 · OH-1004

Cytoplasm0.106

Rank 4 · LXL04_027627 · OH-1004

Extracellular0.075

Rank 5 · LXL04_027627 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04321.24RmlD_sub_bind72-250 aa

PF01370.28Epimerase73-334 aa

PF02719.22Polysacc_synt_273-253 aa

PF16363.12GDP_Man_Dehyd74-389 aa

PF01073.263Beta_HSD74-235 aa

PF07993.19NAD_binding_475-255 aa

PF13460.13NAD_binding_1077-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027627	`PF04321.24`	RmlD_sub_bind	72	250	7.1e-12	45.7
LXL04_027627	`PF01370.28`	Epimerase	73	334	1.3e-52	179.3
LXL04_027627	`PF02719.22`	Polysacc_synt_2	73	253	4.7e-13	49.7
LXL04_027627	`PF16363.12`	GDP_Man_Dehyd	74	389	4.5e-54	184.9
LXL04_027627	`PF01073.26`	3Beta_HSD	74	235	1.3e-14	54.6
LXL04_027627	`PF07993.19`	NAD_binding_4	75	255	2.9e-07	30.6
LXL04_027627	`PF13460.13`	NAD_binding_10	77	249	2.6e-07	31.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA77`	Arabidopsis thaliana	UDP-arabinose 4-epimerase 1	79.756%	Swiss-Prot	strong database homology
`Q9SUN3`	Arabidopsis thaliana	Probable UDP-arabinose 4-epimerase 3	79.805%	Swiss-Prot	strong database homology
`O64749`	Arabidopsis thaliana	Putative UDP-arabinose 4-epimerase 2	77.805%	Swiss-Prot	strong database homology
`Q8H0B6`	Oryza sativa subsp. japonica	Probable UDP-arabinose 4-epimerase 2	81.026%	Swiss-Prot	strong database homology
`Q8H930`	Oryza sativa subsp. japonica	Probable UDP-arabinose 4-epimerase 1	76.399%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card