LXL04_017662 | RubberDandelionOmics

Gene overview

LXL04_017662

Reference: OH-1004 Chr: Chr03 Coordinates: 156207087-156212033 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1275 bp · LXL04_017662|LXL04_017662|OH1004|cDNA

ATGGCGGTAACACAAGGCAAATGGGTGAAGTTGAACCAAAAAGGAACCGGGCCCGGTGCACGAAGCTCACACGGAATCACGATTGTTGGACAAAAAGCATACGCCTTTGGTGGCGAGTTCACCCCACGCGTCCCCATCAACAACTCCCTCTACATCTTCGACCTCACCACCCAAACCTGGTCAACCGCCGAGTCCACAGGCGACATCCCGCCGCCACGTGTCGGCGTCACAATGGCCGCCATCGGGACCACCATCTATGT...

CDS

Download CDS FASTA

1275 bp · LXL04_017662|LXL04_017662|OH1004|CDS

ATGGCGGTAACACAAGGCAAATGGGTGAAGTTGAACCAAAAAGGAACCGGGCCCGGTGCACGAAGCTCACACGGAATCACGATTGTTGGACAAAAAGCATACGCCTTTGGTGGCGAGTTCACCCCACGCGTCCCCATCAACAACTCCCTCTACATCTTCGACCTCACCACCCAAACCTGGTCAACCGCCGAGTCCACAGGCGACATCCCGCCGCCACGTGTCGGCGTCACAATGGCCGCCATCGGGACCACCATCTATGT...

Protein

Download Protein FASTA

424 aa · LXL04_017662|LXL04_017662|OH1004|PROTEIN

MAVTQGKWVKLNQKGTGPGARSSHGITIVGQKAYAFGGEFTPRVPINNSLYIFDLTTQTWSTAESTGDIPPPRVGVTMAAIGTTIYVFGGRDATHTELNELYSFDTLTNEWTLLSTGDTGPTHRSYHSVATDDHRHMYVFGGCGVAGRLNDLWAYDVVENNWVEFPLPGDNLKGRGGPGLGVVGGKIWVVYGFAGMEVDDVHYFDPDGKKWVEVETTGQKPTPRSVFSSVVVGKYVFVCGGEVDPSDLGHMGAGRFTHEV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017662`
TK1151 ID	TkA02G017280
OH-1004 ID	LXL04_017662
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.000
Protein coverage (%)	TK1151 95.092 / OH-1004 73.113 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017662

Location Chr03:156207087-156212033 (-)

Description Similar to NSP5: Nitrile-specifier protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g48180`	Specifier protein that contributes to constitutive and herbivore-induced simple nitrile formation.	Characterization of recombinant nitrile-specifier proteins (NSPs) of Arabidopsis thaliana: dependency on Fe(II) ions and the effect of glucosinolate substrate and reaction conditions.2012 · DOI: 10.1016/j.phytochem.2012.08.004
`At3g16400`	Specifier protein responsible for constitutive and herbivore-induced simple nitrile formation, especially in seedlings and roots.	No verified direct reference in this release
`At3g16410`	Specifier protein that contributes to constitutive and herbivore-induced simple nitrile formation.	No verified direct reference in this release
`At3g16390`	Specifier protein responsible for constitutive and herbivore-induced simple nitrile formation, especially in roots.	No verified direct reference in this release
`At2g33070`	Specifier protein responsible for constitutive and herbivore-induced simple nitrile formation, especially in seeds.	Nitrile-specifier proteins involved in glucosinolate hydrolysis in Arabidopsis thaliana.2009 · DOI: 10.1074/jbc.m807500200 Characterization of recombinant nitrile-specifier proteins (NSPs) of Arabidopsis thaliana: dependency on Fe(II) ions and the effect of glucosinolate substrate and reaction conditions.2012 · DOI: 10.1016/j.phytochem.2012.08.004 NSP-Dependent Simple Nitrile Formation Dominates upon Breakdown of Major Aliphatic Glucosinolates in Roots, Seeds, and Seedlings of Arabidopsis thaliana Columbia-0.2016 · DOI: 10.3389/fpls.2016.01821 Glucosinolate Content in Dormant and Germinating Arabidopsis thaliana Seeds Is Affected by Non-Functional Alleles of Classical Myrosinase and Nitrile-Specifier Protein Genes.2019 · DOI: 10.3389/fpls.2019.01549

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017662 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009845 seed germination Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0019762 glucosinolate catabolic process Biological Process

GO:0080027 response to herbivore Biological Process

GO:0080028 nitrile biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT2G33070

ath:AT3G16390

ath:AT3G16400

ath:AT3G16410

ath:AT5G48180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.612

Rank 1 · LXL04_017662 · OH-1004

Nucleus0.361

Rank 2 · LXL04_017662 · OH-1004

Peroxisome0.117

Rank 3 · LXL04_017662 · OH-1004

Mitochondrion0.093

Rank 4 · LXL04_017662 · OH-1004

Cell membrane0.053

Rank 5 · LXL04_017662 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24981.2Beta-prop_ATRN-LZTR13-81 aa

PF24681.2Kelch_KLHDC2_KLHL20_DRC75-38 aa

PF13415.13Beta-prop_FBX425-111 aa

PF13964.13Beta-prop_Calicin6-145 aa

PF13854.13Kelch_HCF8-94 aa

PF01344.32Kelch_120-63 aa

PF25210.2Kelch_FKB9521-137 aa

PF24681.2Kelch_KLHDC2_KLHL20_DRC724-241 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017662	`PF24981.2`	Beta-prop_ATRN-LZTR1	3	81	1.2e-36	127.3
LXL04_017662	`PF24681.2`	Kelch_KLHDC2_KLHL20_DRC7	5	38	1.4e-73	247.6
LXL04_017662	`PF13415.13`	Beta-prop_FBX42	5	111	7.9e-46	157.0
LXL04_017662	`PF13964.13`	Beta-prop_Calicin	6	145	1.5e-11	44.6
LXL04_017662	`PF13854.13`	Kelch_HCF	8	94	5.9e-24	85.7
LXL04_017662	`PF01344.32`	Kelch_1	20	63	9e-42	140.9
LXL04_017662	`PF25210.2`	Kelch_FKB95	21	137	1.5e-16	61.5
LXL04_017662	`PF24681.2`	Kelch_KLHDC2_KLHL20_DRC7	24	241	1.4e-73	247.6
LXL04_017662	`PF24996.1`	NANM	48	143	2.3e-08	34.0
LXL04_017662	`PF13418.13`	Beta-prop_TYW4	70	162	1.1e-08	36.1
LXL04_017662	`PF01344.32`	Kelch_1	72	115	9e-42	140.9
LXL04_017662	`PF13415.13`	Beta-prop_FBX42	82	130	7.9e-46	157.0
LXL04_017662	`PF24981.2`	Beta-prop_ATRN-LZTR1	85	164	1.2e-36	127.3
LXL04_017662	`PF13854.13`	Kelch_HCF	106	192	5.9e-24	85.7
LXL04_017662	`PF13415.13`	Beta-prop_FBX42	124	291	7.9e-46	157.0
LXL04_017662	`PF01344.32`	Kelch_1	124	165	9e-42	140.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93XW5`	Arabidopsis thaliana	Thiohydroximate-O-sulfate sulfur/sulfate-lyase (nitrile-forming) NSP5	54.194%	Swiss-Prot	strong database homology
`Q9SDM9`	Arabidopsis thaliana	Thiohydroximate-O-sulfate sulfur/sulfate-lyase (nitrile-forming) NSP1	52.443%	Swiss-Prot	strong database homology
`O04316`	Arabidopsis thaliana	Thiohydroximate-O-sulfate sulfur/sulfate-lyase (nitrile-forming) NSP4	51.623%	Swiss-Prot	strong database homology
`O04318`	Arabidopsis thaliana	Thiohydroximate-O-sulfate sulfur/sulfate-lyase (nitrile-forming) NSP3	49.346%	Swiss-Prot	moderate database homology
`O49326`	Arabidopsis thaliana	Thiohydroximate-O-sulfate sulfur/sulfate-lyase (nitrile-forming) NSP2	49.673%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card