LXL04_016970 | RubberDandelionOmics

Gene overview

LXL04_016970

Reference: OH-1004 Chr: Chr03 Coordinates: 138159776-138162557 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1296 bp · LXL04_016970|LXL04_016970|OH1004|cDNA

ATGGGTTTCTCTTTGATTTTGATCTTAATTCTTTCTTCATTCATCTTCGATCTTCTATCTCCGACATATGGATATGATTCACTGGATCCTAATGGCAATATCACCATCAAATGGGATCTCCGGCAGCAGAATGACGGAACACAGGATATACTAGTTTCGATCTACAACTATCAATTATATCGGCACATAGAGACTCCTGGATGGAAGCTAAGTTGGAAATGGAGTGGCAAAGAAGTAATTTGGGACATGAGAGGGGCCGA...

CDS

Download CDS FASTA

1296 bp · LXL04_016970|LXL04_016970|OH1004|CDS

ATGGGTTTCTCTTTGATTTTGATCTTAATTCTTTCTTCATTCATCTTCGATCTTCTATCTCCGACATATGGATATGATTCACTGGATCCTAATGGCAATATCACCATCAAATGGGATCTCCGGCAGCAGAATGACGGAACACAGGATATACTAGTTTCGATCTACAACTATCAATTATATCGGCACATAGAGACTCCTGGATGGAAGCTAAGTTGGAAATGGAGTGGCAAAGAAGTAATTTGGGACATGAGAGGGGCCGA...

Protein

Download Protein FASTA

431 aa · LXL04_016970|LXL04_016970|OH1004|PROTEIN

MGFSLILILILSSFIFDLLSPTYGYDSLDPNGNITIKWDLRQQNDGTQDILVSIYNYQLYRHIETPGWKLSWKWSGKEVIWDMRGAEATEQGNCSQYLGKPQLPHSCEREPVIVDLLPGSPYNMQVQNCCKGGVLSSFSQDPGNSMAAFQMNVGSIATMPYNFNIGIPGYTCGNATNVPPTKFVTDHGRRQTQALGTWNITCTYSPFLASSAPKCCVSLSSFYSKTIVPCPVCSCACQGEPGSNCVRHGQMHSVLRLPPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016970`
TK1151 ID	TkA02G086800
OH-1004 ID	LXL04_016970
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016970

Location Chr03:138159776-138162557 (+)

Description Similar to BC1L6: COBRA-like protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09790`	COBRA-like protein 6.	No verified direct reference in this release
`At3g02210`	COBRA-like protein 1.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0604300`	Involved in determining the orientation of cell expansion, probably by playing an important role in cellulose deposition.	No verified direct reference in this release
`Os03g0416300`	COBRA-like protein 2.	No verified direct reference in this release
`Os05g0386800`	Involved in determining the orientation of cell expansion, probably by playing an important role in cellulose deposition.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016970 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010215 cellulose microfibril organization Biological Process

GO:0052324 plant-type cell wall cellulose biosynthetic process Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0098552 side of membrane Cellular Component

KEGG gene cross-reference

ath:AT1G09790

ath:AT3G02210

dosa:Os03g0416300

dosa:Os05g0386800

dosa:Os07g0604300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.761

Rank 1 · LXL04_016970 · OH-1004

Cytoplasm0.103

Rank 2 · LXL04_016970 · OH-1004

Endoplasmic reticulum0.087

Rank 3 · LXL04_016970 · OH-1004

Extracellular0.085

Rank 4 · LXL04_016970 · OH-1004

Lysosome / Vacuole0.082

Rank 5 · LXL04_016970 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04833.21COBRA_N51-205 aa

PF25079.2COB_C214-399 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016970	`PF04833.21`	COBRA_N	51	205	1.1e-58	198.5
LXL04_016970	`PF25079.2`	COB_C	214	399	2.9e-43	149.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04500`	Arabidopsis thaliana	COBRA-like protein 6	55.269%	Swiss-Prot	strong database homology
`Q9SRT7`	Arabidopsis thaliana	COBRA-like protein 1	50.909%	Swiss-Prot	strong database homology
`Q6Z4G8`	Oryza sativa subsp. japonica	COBRA-like protein 1	52.489%	Swiss-Prot	strong database homology
`Q75IW1`	Oryza sativa subsp. japonica	COBRA-like protein 2	54.545%	Swiss-Prot	strong database homology
`Q60E70`	Oryza sativa subsp. japonica	COBRA-like protein 3	53.023%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card