LXL04_016442 | RubberDandelionOmics

Gene overview

LXL04_016442

Reference: OH-1004 Chr: Chr03 Coordinates: 123480030-123486077 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3351 bp · LXL04_016442|LXL04_016442|OH1004|cDNA

ATGATAGTTCGGAGTTCTTTGGAGGAAATGCTCGACTCTCTCCAGCGGAAAGAGGAGAGCAAGAAGCCAACGGACTTGCCGCCGGCGTTACCTGCACGGCCCGCATCCAAGGCACGTCTTCCTAAGCGTCCGGGTCTGGCCATGTTTGGCGTGTCGACCGAGGTTGGTGACAGAAGGAGGCCAGAGTTTACAAGCAACGGTAGTTTTGGCCGGAAAAAAGTGTTTGAAACGGCTTCATGTGGTGAGTCGCCTTACACCAT...

CDS

Download CDS FASTA

3351 bp · LXL04_016442|LXL04_016442|OH1004|CDS

ATGATAGTTCGGAGTTCTTTGGAGGAAATGCTCGACTCTCTCCAGCGGAAAGAGGAGAGCAAGAAGCCAACGGACTTGCCGCCGGCGTTACCTGCACGGCCCGCATCCAAGGCACGTCTTCCTAAGCGTCCGGGTCTGGCCATGTTTGGCGTGTCGACCGAGGTTGGTGACAGAAGGAGGCCAGAGTTTACAAGCAACGGTAGTTTTGGCCGGAAAAAAGTGTTTGAAACGGCTTCATGTGGTGAGTCGCCTTACACCAT...

Protein

Download Protein FASTA

1116 aa · LXL04_016442|LXL04_016442|OH1004|PROTEIN

MIVRSSLEEMLDSLQRKEESKKPTDLPPALPARPASKARLPKRPGLAMFGVSTEVGDRRRPEFTSNGSFGRKKVFETASCGESPYTMVAVDENRLAENGGANLATPLPPSSRSGWDNSIDYYIKKQLRVWCRLQNGFWELGKIQSDFGGKASVILLDGTVMTVSTRDLFPTNTEILDGVNNLVELGYLNEPSVLYNIQYRYQRDVIYTMAGPVLLAINPFKDVSVSGSDLIMAYKEKILDSPHVYKIADVAYTNMMRDGV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016442`
TK1151 ID	TkA02G140780
OH-1004 ID	LXL04_016442
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 67.294 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016442

Location Chr03:123480030-123486077 (-)

Description Similar to VIII-2: Myosin-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g54280`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At4g27370`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At3g19960`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At1g50360`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At1g17580`	Myosin heavy chain that is required for the cell cycle- regulated transport of various organelles and proteins for their segregation.	Enzymatic activity and motility of recombinant Arabidopsis myosin XI, MYA1.2007 · DOI: 10.1093/pcp/pcm054 A comparative study of the involvement of 17 Arabidopsis myosin family members on the motility of Golgi and other organelles.2009 · DOI: 10.1104/pp.109.136853 Myosin XIK is a major player in cytoplasm dynamics and is regulated by two amino acids in its tail.2012 · DOI: 10.1093/jxb/err265

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016442 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006897 endocytosis Biological Process

GO:0007015 actin filament organization Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010154 fruit development Biological Process

GO:0030048 actin filament-based movement Biological Process

GO:0048467 gynoecium development Biological Process

GO:0051301 cell division Biological Process

GO:0051645 Golgi localization Biological Process

GO:0051646 mitochondrion localization Biological Process

KEGG gene cross-reference

ath:AT1G17580

ath:AT1G50360

ath:AT3G19960

ath:AT4G27370

ath:AT5G54280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.583

Rank 1 · LXL04_016442 · OH-1004

Nucleus0.235

Rank 2 · LXL04_016442 · OH-1004

Cell membrane0.147

Rank 3 · LXL04_016442 · OH-1004

Plastid0.081

Rank 4 · LXL04_016442 · OH-1004

Golgi apparatus0.050

Rank 5 · LXL04_016442 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25369.2SH3_VIII-1_N127-170 aa

PF00063.28Myosin_head179-674 aa

PF00063.28Myosin_head678-798 aa

PF00612.34IQ878-896 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016442	`PF25369.2`	SH3_VIII-1_N	127	170	4.3e-15	55.5
LXL04_016442	`PF00063.28`	Myosin_head	179	674	1.8e-190	635.3
LXL04_016442	`PF00063.28`	Myosin_head	678	798	1.8e-190	635.3
LXL04_016442	`PF00612.34`	IQ	878	896	3.5e-08	33.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K0A6`	Arabidopsis thaliana	Myosin-2	48.321%	Swiss-Prot	moderate database homology
`F4JIU4`	Arabidopsis thaliana	Myosin-4	47.170%	Swiss-Prot	moderate database homology
`Q9LHE9`	Arabidopsis thaliana	Myosin-1	46.333%	Swiss-Prot	moderate database homology
`F4I507`	Arabidopsis thaliana	Myosin-3	45.446%	Swiss-Prot	moderate database homology
`Q39160`	Arabidopsis thaliana	Myosin-5	38.129%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card