LXL04_037505 | RubberDandelionOmics

Gene overview

LXL04_037505

Reference: OH-1004 Chr: Chr09 Coordinates: 12417464-12419600 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1113 bp · LXL04_037505|LXL04_037505|OH1004|cDNA

ATGGCGAAGATAACATTAGGCTGCGAACCAGTCATCGGATCACTAACCCCGTCGAAGAAGAGAGATTACAGAGTCACCAACAGGCTACAGGAAGGCAAACGCCCAATTTACGCCGTCGTTTTCAACTTCATCGACTCTCGTTATTACAACGTCTTCGCCACTGTCGGTGGTAATCGCGTTACGGTATACCAATGCCTTGAAGGCGGCGTAATTGCTGTACTACAGTCCTACATTGACGAAGATAAAGACGAGTCGTTCTA...

CDS

Download CDS FASTA

1113 bp · LXL04_037505|LXL04_037505|OH1004|CDS

ATGGCGAAGATAACATTAGGCTGCGAACCAGTCATCGGATCACTAACCCCGTCGAAGAAGAGAGATTACAGAGTCACCAACAGGCTACAGGAAGGCAAACGCCCAATTTACGCCGTCGTTTTCAACTTCATCGACTCTCGTTATTACAACGTCTTCGCCACTGTCGGTGGTAATCGCGTTACGGTATACCAATGCCTTGAAGGCGGCGTAATTGCTGTACTACAGTCCTACATTGACGAAGATAAAGACGAGTCGTTCTA...

Protein

Download Protein FASTA

370 aa · LXL04_037505|LXL04_037505|OH1004|PROTEIN

MAKITLGCEPVIGSLTPSKKRDYRVTNRLQEGKRPIYAVVFNFIDSRYYNVFATVGGNRVTVYQCLEGGVIAVLQSYIDEDKDESFYTVSWACDANGTPLLVAGGINGIIRVIDAGNEKIHKSFVGHGDSVNEIRTQPLRPSLVLSASKDESVRLWNVQTGICILIFAGAGGHRNEVLSVDFHPSDIYRIASCGMDNTVKIWSMKEFWTYVERSFTWEGPPSQFPTKYVQFPVLIASIHTNYVDCNRWLGDFILSKSVDN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037505`
TK1151 ID	TkA04G314550
OH-1004 ID	LXL04_037505
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037505

Location Chr09:12417464-12419600 (+)

Description Similar to FIE2: Polycomb group protein FIE1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20740`	Polycomb group (PcG) protein.	Polycomb group genes control pattern formation in plant seed.2001 · DOI: 10.1016/s0960-9822(01)00072-0

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0137100`	Polycomb group (PcG) protein.	Polycomb group gene OsFIE2 regulates rice (Oryza sativa) seed development and grain filling via a mechanism distinct from Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003322 OsFIE2 plays an essential role in the regulation of rice vegetative and reproductive development.2014 · DOI: 10.1111/nph.12472
`Os08g0137250`	Polycomb group (PcG) protein.	Identification and characterization of an epi-allele of FIE1 reveals a regulatory linkage between two epigenetic marks in rice.2012 · DOI: 10.1105/tpc.112.102269 Imprinted gene OsFIE1 modulates rice seed development by influencing nutrient metabolism and modifying genome H3K27me3.2016 · DOI: 10.1111/tpj.13202

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037505 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009409 response to cold Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009908 flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0009960 endosperm development Biological Process

GO:0010048 vernalization response Biological Process

GO:0010231 maintenance of seed dormancy Biological Process

GO:0030154 cell differentiation Biological Process

GO:0031507 heterochromatin formation Biological Process

GO:0045815 transcription initiation-coupled chromatin remodeling Biological Process

KEGG gene cross-reference

ath:AT3G20740

dosa:Os08g0137100

dosa:Os08g0137250

osa:9271694

zma:542075

zma:542076

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.534

Rank 1 · LXL04_037505 · OH-1004

Nucleus0.426

Rank 2 · LXL04_037505 · OH-1004

Lysosome / Vacuole0.099

Rank 3 · LXL04_037505 · OH-1004

Cell membrane0.090

Rank 4 · LXL04_037505 · OH-1004

Golgi apparatus0.066

Rank 5 · LXL04_037505 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24807.2WD40_CDC20-Fz41-207 aa

PF25174.2Beta-prop_THOC385-164 aa

PF25173.2Beta-prop_WDR3_1st95-203 aa

PF24814.2WD40_Prp1995-206 aa

PF23381.2Beta-prop_IFT122_1st96-167 aa

PF25175.2Beta-prop_WDR5100-205 aa

PF24817.2WD40_WDHD1_1st100-164 aa

PF25172.2Beta-prop_WDR3_2nd102-204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037505	`PF24807.2`	WD40_CDC20-Fz	41	207	2.8e-18	66.9
LXL04_037505	`PF25174.2`	Beta-prop_THOC3	85	164	5.7e-23	82.0
LXL04_037505	`PF25173.2`	Beta-prop_WDR3_1st	95	203	5.7e-20	72.5
LXL04_037505	`PF24814.2`	WD40_Prp19	95	206	3.6e-19	69.6
LXL04_037505	`PF23381.2`	Beta-prop_IFT122_1st	96	167	4.5e-20	72.8
LXL04_037505	`PF25175.2`	Beta-prop_WDR5	100	205	1.5e-22	80.9
LXL04_037505	`PF24817.2`	WD40_WDHD1_1st	100	164	5.9e-18	65.8
LXL04_037505	`PF25172.2`	Beta-prop_WDR3_2nd	102	204	2.4e-10	40.9
LXL04_037505	`PF23869.2`	Beta-prop_WDR75_1st	108	167	2.8e-09	37.5
LXL04_037505	`PF25168.2`	Beta-prop_WDR36-Utp21_2nd	109	210	2e-07	31.3
LXL04_037505	`PF25391.2`	WD40_Gbeta	113	204	4.8e-07	29.8
LXL04_037505	`PF25047.1`	Beta-prop_TEP1_2nd	142	205	7.6e-14	52.2
LXL04_037505	`PF25174.2`	Beta-prop_THOC3	171	205	5.7e-23	82.0
LXL04_037505	`PF23381.2`	Beta-prop_IFT122_1st	172	207	4.5e-20	72.8
LXL04_037505	`PF00400.39`	WD40	172	203	5.9e-20	71.5
LXL04_037505	`PF24817.2`	WD40_WDHD1_1st	172	206	5.9e-18	65.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LT47`	Arabidopsis thaliana	Polycomb group protein FERTILIZATION-INDEPENDENT ENDOSPERM	74.457%	Swiss-Prot	strong database homology
`Q6ZJX0`	Oryza sativa subsp. japonica	Polycomb group protein FIE1	77.089%	Swiss-Prot	strong database homology
`Q6ZJW8`	Oryza sativa subsp. japonica	Polycomb group protein FIE1	67.655%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card