LXL04_035845 | RubberDandelionOmics

Gene overview

LXL04_035845

Reference: OH-1004 Chr: Chr08 Coordinates: 30516743-30520492 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

921 bp · LXL04_035845|LXL04_035845|OH1004|cDNA

ATTAGCAACAATTATGGTGAGATGGAAATCATAGATGACAACATGGAAAAGTTCACCACAAAAACACTGAtcatgatgatgatgaagaaaaAGATATGAAACTCCCAATATCTCTCATCCACCTCGTCTTCACATCTTATCCACCAGATTCCACTCCATCTTCTATTTCTATTTCTTCATACTAATTTCAATTCATCGTCATTCTTTCAACCATCTCTACAAGCAGATCGTAGATCGATGGCTTTCACAGTCTCCACAAG...

CDS

Download CDS FASTA

684 bp · LXL04_035845|LXL04_035845|OH1004|CDS

ATGGCTTTCACAGTCTCCACAAGCTTCCTCCAACCACTCGAATTATCCAAATCCTCGCAGTTCGGATCCAAATTAAAGGCTACCAGCCCCAGTATCGTGTGTTCTGGATCCACAGAAGATAAAACCAAAGAAAAAGGTTCGTTGAAAGCTTTCTCAGCAGCTCTCGCGCTCTCTTCCATCCTGATTTCGTCGACTGTGCCTGCACTTCCGGCGTCCGCTGATATCTCGGGACTCACTCCGTGCAAAGACTCCAAGCAGTT...

Protein

Download Protein FASTA

227 aa · LXL04_035845|LXL04_035845|OH1004|PROTEIN

MAFTVSTSFLQPLELSKSSQFGSKLKATSPSIVCSGSTEDKTKEKGSLKAFSAALALSSILISSTVPALPASADISGLTPCKDSKQFAKREKQSLKKLESSLKLYAPDSAPALAIKATMEKTKRRFDNYGKQGLLCGSDGLPHLIVSGDQRHWGEFITPGILFLYIAGWIGWVGRSYLIAIRDEKKPTQKEIIFDVPLASRLVFRGFSWPVAAYREFLNGELIDPTV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035845`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035845

Location Chr08:30516743-30520492 (+)

Description Similar to PSAF: Photosystem I reaction center subunit III, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31330`	Participates in efficiency of electron transfer from plastocyanin to P700 (or cytochrome c553 in algae and cyanobacteria).	Down-regulation of the PSI-F subunit of photosystem I (PSI) in Arabidopsis thaliana. The PSI-F subunit is essential for photoautotrophic growth and contributes to antenna function.2000 · DOI: 10.1074/jbc.m002933200

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035845 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0015979 photosynthesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009538 photosystem I reaction center Cellular Component

GO:0009543 chloroplast thylakoid lumen Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0019904 protein domain specific binding Molecular Function

KEGG gene cross-reference

ath:AT1G31330

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.980

Rank 1 · LXL04_035845 · OH-1004

Mitochondrion0.022

Rank 2 · LXL04_035845 · OH-1004

Nucleus0.012

Rank 3 · LXL04_035845 · OH-1004

Cytoplasm0.011

Rank 4 · LXL04_035845 · OH-1004

Cell membrane0.009

Rank 5 · LXL04_035845 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02507.21PSI_PsaF61-225 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035845	`PF02507.21`	PSI_PsaF	61	225	1.4e-78	263.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHE8`	Arabidopsis thaliana	Photosystem I reaction center subunit III, chloroplastic	78.061%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card