LXL04_032857 | RubberDandelionOmics

Gene overview

LXL04_032857

Reference: OH-1004 Chr: Chr07 Coordinates: 30622590-30625385 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1047 bp · LXL04_032857|LXL04_032857|OH1004|cDNA

ATGTTCACCACAACACCACCGGACGCCACCCTAAACCACCGTACCACCACCGGAATCTCATCATTACCCACCGATATACTAGAGTCCCATATACTTACTCGTCTCAACGGTCAAACCTTAGCTTCCGCCGCATGCGCCTCCGTGTCCCTCTCCGCCGGCCACCACAACCACCAACTCTGGTCCAACATCTGCCACTCCACATGGCCCTCAACCGCCAGTGACCGTATCAGCAAAATCATTTCCACTTTCTCCGACGACAA...

CDS

Download CDS FASTA

1047 bp · LXL04_032857|LXL04_032857|OH1004|CDS

ATGTTCACCACAACACCACCGGACGCCACCCTAAACCACCGTACCACCACCGGAATCTCATCATTACCCACCGATATACTAGAGTCCCATATACTTACTCGTCTCAACGGTCAAACCTTAGCTTCCGCCGCATGCGCCTCCGTGTCCCTCTCCGCCGGCCACCACAACCACCAACTCTGGTCCAACATCTGCCACTCCACATGGCCCTCAACCGCCAGTGACCGTATCAGCAAAATCATTTCCACTTTCTCCGACGACAA...

Protein

Download Protein FASTA

348 aa · LXL04_032857|LXL04_032857|OH1004|PROTEIN

MFTTTPPDATLNHRTTTGISSLPTDILESHILTRLNGQTLASAACASVSLSAGHHNHQLWSNICHSTWPSTASDRISKIISTFSDDKNGPRSFFSQSFPLPTSEPTTVSPSPQHPTSFPPASELISAVDIYYRNKPILTKTKETETISDWFRCSQFRIDMLDPKDVIRTQIPQPIGEATCTALMEEMTLSWILIDPVNKRSVNLSSHKPVSVHRHWLSGEVRVCYVSILGGGGGVVVQCVIVVNCGGSEEGEMQVREVTM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032857`
TK1151 ID	TkA01G112040
OH-1004 ID	LXL04_032857
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	64.100
Protein coverage (%)	TK1151 91.884 / OH-1004 91.379 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032857

Location Chr07:30622590-30625385 (+)

Description Similar to At2g36090: Probable F-box protein At2g36090

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36090`	Probable F-box protein At2g36090.	No verified direct reference in this release
`At3g44326`	F-box protein At3g44326.	No verified direct reference in this release
`At2g27310`	F-box protein At2g27310.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032857 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009620 response to fungus Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0019218 regulation of steroid metabolic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0019005 SCF ubiquitin ligase complex Cellular Component

KEGG gene cross-reference

ath:AT2G27310

ath:AT2G36090

ath:AT3G44326

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.715

Rank 1 · LXL04_032857 · OH-1004

Cytoplasm0.273

Rank 2 · LXL04_032857 · OH-1004

Cell membrane0.101

Rank 3 · LXL04_032857 · OH-1004

Endoplasmic reticulum0.093

Rank 4 · LXL04_032857 · OH-1004

Plastid0.039

Rank 5 · LXL04_032857 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIH5`	Arabidopsis thaliana	Probable F-box protein At2g36090	45.486%	Swiss-Prot	moderate database homology
`Q2V3R1`	Arabidopsis thaliana	F-box protein At3g44326	40.764%	Swiss-Prot	moderate database homology
`Q9XIN8`	Arabidopsis thaliana	F-box protein At2g27310	40.557%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card