LXL04_028340 | RubberDandelionOmics

Gene overview

LXL04_028340

Reference: OH-1004 Chr: Chr06 Coordinates: 38452030-38455640 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2619 bp · LXL04_028340|LXL04_028340|OH1004|cDNA

TGTATATTTTGAAATTCGTAGCCGTTATCCATTTTGACACCCACAACAATGTTCCAACATCCTCCTTTCTTGTTCACTTACTCCCGCCACTTCCTACGCCGCCGCCACGCCGGCCACCACCTATCAACACCGCCTATTCGTCACCGTTTCCTCTCAACTATCACACACACGCTTTCACACCCTATCTATACCATATGGGCCGCCAACACTGGTCTTGGCAAAACCCTCGTTTCCACCGGCCTCGCCGCCTCCTCCCTCCA...

CDS

Download CDS FASTA

2586 bp · LXL04_028340|LXL04_028340|OH1004|CDS

TTGACACCCACAACAATGTTCCAACATCCTCCTTTCTTGTTCACTTACTCCCGCCACTTCCTACGCCGCCGCCACGCCGGCCACCACCTATCAACACCGCCTATTCGTCACCGTTTCCTCTCAACTATCACACACACGCTTTCACACCCTATCTATACCATATGGGCCGCCAACACTGGTCTTGGCAAAACCCTCGTTTCCACCGGCCTCGCCGCCTCCTCCCTCCACTCTTCCTCCCCATCCCCTTCCAAATTAGTCTA...

Protein

Download Protein FASTA

861 aa · LXL04_028340|LXL04_028340|OH1004|PROTEIN

MTPTTMFQHPPFLFTYSRHFLRRRHAGHHLSTPPIRHRFLSTITHTLSHPIYTIWAANTGLGKTLVSTGLAASSLHSSSPSPSKLVYIKPLQTGFPLDSDSAFIYRKVPQILLLRNPQSTLLASNQTLNVSVPAAKLKIGNNFSEEGQSSKNGFETSGYYEERKLGIGEEVQSELICKTMYAWKEAISPHLAAEREGSNVEDSDVLVMLKKCLETGIGSKGDERTTVLCLVETAGGVASPGSTGSLQCDLYRPFRLPSIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028340`
TK1151 ID	TkA07G144630
OH-1004 ID	LXL04_028340
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.800
Protein coverage (%)	TK1151 95.465 / OH-1004 48.897 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028340

Location Chr06:38452030-38455640 (-)

Description Similar to BIO3-BIO1: Bifunctional dethiobiotin synthetase/7,8-diamino-pelargonic acid aminotransferase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57590`	Bifunctional enzyme that catalyzes two different reactions involved in the biotin biosynthesis.	The role of biotin in regulating 3-methylcrotonyl-coenzyme a carboxylase expression in Arabidopsis.2003 · DOI: 10.1104/pp.013243 Arrested Embryos from the bio1 Auxotroph of Arabidopsis thaliana Contain Reduced Levels of Biotin.1990 · DOI: 10.1104/pp.93.3.1162 A bifunctional locus (BIO3-BIO1) required for biotin biosynthesis in Arabidopsis.2008 · DOI: 10.1104/pp.107.107409 Biochemical and structural characterization of the Arabidopsis bifunctional enzyme dethiobiotin synthetase-diaminopelargonic acid aminotransferase: evidence for substrate channeling in biotin synthesis.2012 · DOI: 10.1105/tpc.112.097675 SUCROSE TRANSPORTER 5 supplies Arabidopsis embryos with biotin and affects triacylglycerol accumulation.2013 · DOI: 10.1111/tpj.12037 An embryo-lethal mutant of Arabidopsis thaliana is a biotin auxotroph.1989 · DOI: 10.1016/s0012-1606(89)80047-8 Complementation of an Arabidopsis thaliana biotin auxotroph with an Escherichia coli biotin biosynthetic gene.1996 · DOI: 10.1007/bf02172516

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0245400`	Bifunctional enzyme that catalyzes two different reactions involved in the biotin biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028340 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009102 biotin biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0004015 adenosylmethionine-8-amino-7-oxononanoate transaminase activity Molecular Function

GO:0004141 dethiobiotin synthase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030170 pyridoxal phosphate binding Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ani:ANIA_06644

ath:AT5G57590

dosa:Os08g0245400

hin:HI_1554

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.442

Rank 1 · LXL04_028340 · OH-1004

Plastid0.263

Rank 2 · LXL04_028340 · OH-1004

Cytoplasm0.178

Rank 3 · LXL04_028340 · OH-1004

Peroxisome0.115

Rank 4 · LXL04_028340 · OH-1004

Nucleus0.087

Rank 5 · LXL04_028340 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13500.13AAA_26178-319 aa

PF00202.28Aminotran_3426-528 aa

PF00202.28Aminotran_3617-843 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028340	`PF13500.13`	AAA_26	178	319	5.2e-13	50.0
LXL04_028340	`PF00202.28`	Aminotran_3	426	528	6.3e-47	160.9
LXL04_028340	`PF00202.28`	Aminotran_3	617	843	6.3e-47	160.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`B0F481`	Arabidopsis thaliana	Bifunctional dethiobiotin synthetase/7,8-diamino-pelargonic acid aminotransferase, mitochondrial	64.259%	Swiss-Prot	strong database homology
`Q6ZKV8`	Oryza sativa subsp. japonica	Bifunctional dethiobiotin synthetase/7,8-diamino-pelargonic acid aminotransferase, mitochondrial	57.959%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card