LXL04_026783 | RubberDandelionOmics

Gene overview

LXL04_026783

Reference: OH-1004 Chr: Chr06 Coordinates: 2838554-2839372 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

819 bp · LXL04_026783|LXL04_026783|OH1004|cDNA

ATGAACTCACCATCGCCGCCGTACACAACCCATCAACCACCACTTGAAAGAGGTACTTCCACAGGTGGGTGTCCGTTGGTTGCATTAAAGAAAGAAGCTTTATTGGAAGAAAAGGTATTTAATTCGGCTCCGGCTGCGGCTCCGCCGTCGAGGAGGTCATCCACCAAGGACCGCCACACAAAGGTGGAGGGTAGAGGAAGAAGGATCCGAATGCCGGCAACCTGCGCCGCGAGGATATTCCAGCTGACGAGAGAACTTGG...

CDS

Download CDS FASTA

819 bp · LXL04_026783|LXL04_026783|OH1004|CDS

ATGAACTCACCATCGCCGCCGTACACAACCCATCAACCACCACTTGAAAGAGGTACTTCCACAGGTGGGTGTCCGTTGGTTGCATTAAAGAAAGAAGCTTTATTGGAAGAAAAGGTATTTAATTCGGCTCCGGCTGCGGCTCCGCCGTCGAGGAGGTCATCCACCAAGGACCGCCACACAAAGGTGGAGGGTAGAGGAAGAAGGATCCGAATGCCGGCAACCTGCGCCGCGAGGATATTCCAGCTGACGAGAGAACTTGG...

Protein

Download Protein FASTA

272 aa · LXL04_026783|LXL04_026783|OH1004|PROTEIN

MNSPSPPYTTHQPPLERGTSTGGCPLVALKKEALLEEKVFNSAPAAAPPSRRSSTKDRHTKVEGRGRRIRMPATCAARIFQLTRELGHKSDGETIQWLLQHAEPSIIAATGTGTIPAIAMSVNGTLKIPTTTTSAAATTTLASIQKKRKLPYDFDINRNENTPITDTVASSSTSVLAPLMTTIAQPQSFVPVWAIPYNGTTAFWAFQPYTAPSLNISATPISFFTSGDQKPSAMATTTSEITQSFTDFPINRHERKEFSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026783`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026783

Location Chr06:2838554-2839372 (-)

Description Similar to TCP9: Transcription factor TCP9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45680`	Transcription factor TCP9.	No verified direct reference in this release
`At5g51910`	Transcription factor TCP19.	No verified direct reference in this release
`At1g69690`	Transcription factor involved the regulation of plant development.	TCP14 and TCP15 affect internode length and leaf shape in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2011.04674.x The Arabidopsis O-linked N-acetylglucosamine transferase SPINDLY interacts with class I TCPs to facilitate cytokinin responses in leaves and flowers.2012 · DOI: 10.1105/tpc.111.093518 The Arabidopsis immune adaptor SRFR1 interacts with TCP transcription factors that redundantly contribute to effector-triggered immunity.2014 · DOI: 10.1111/tpj.12527 The ubiquitin receptors DA1, DAR1, and DAR2 redundantly regulate endoreduplication by modulating the stability of TCP14/15 in Arabidopsis.2015 · DOI: 10.1105/tpc.114.132274 TCP15 modulates cytokinin and auxin responses during gynoecium development in Arabidopsis.2015 · DOI: 10.1111/tpj.12992 Redox-Dependent Modulation of Anthocyanin Biosynthesis by the TCP Transcription Factor TCP15 during Exposure to High Light Intensity Conditions in Arabidopsis.2016 · DOI: 10.1104/pp.15.01016

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0544800`	Transcription activator.	DNA binding and dimerization specificity and potential targets for the TCP protein family.2002 · DOI: 10.1046/j.1365-313x.2002.01294.x PCF1 and PCF2 specifically bind to cis elements in the rice proliferating cell nuclear antigen gene.1997 · DOI: 10.1105/tpc.9.9.1607
`UniProt: A2YXQ1`	Transcription activator.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026783 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0008361 regulation of cell size Biological Process

GO:0009624 response to nematode Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0010229 inflorescence development Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0031540 regulation of anthocyanin biosynthetic process Biological Process

GO:0042023 DNA endoreduplication Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048364 root development Biological Process

KEGG gene cross-reference

ath:AT1G69690

ath:AT2G45680

ath:AT5G51910

dosa:Os08g0544800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.937

Rank 1 · LXL04_026783 · OH-1004

Cytoplasm0.188

Rank 2 · LXL04_026783 · OH-1004

Mitochondrion0.019

Rank 3 · LXL04_026783 · OH-1004

Cell membrane0.015

Rank 4 · LXL04_026783 · OH-1004

Endoplasmic reticulum0.008

Rank 5 · LXL04_026783 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03634.20TCP54-147 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026783	`PF03634.20`	TCP	54	147	1e-27	98.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64647`	Arabidopsis thaliana	Transcription factor TCP9	57.754%	Swiss-Prot	moderate database homology
`Q9LT89`	Arabidopsis thaliana	Transcription factor TCP19	46.667%	Swiss-Prot	moderate database homology
`Q9C9L2`	Arabidopsis thaliana	Transcription factor TCP15	79.518%	Swiss-Prot	weak database homology
`Q6ZBH6`	Oryza sativa subsp. japonica	Transcription factor PCF2	48.889%	Swiss-Prot	moderate database homology
`A2YXQ1`	Oryza sativa subsp. indica	Transcription factor PCF2	48.889%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card