LXL04_021574 | RubberDandelionOmics

Gene overview

LXL04_021574

Reference: OH-1004 Chr: Chr04 Coordinates: 132599114-132607440 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1512 bp · LXL04_021574|LXL04_021574|OH1004|cDNA

ATGGCCGATTCTTACTGGAAATATGCTGCCGCTGACGGTAGGCAGCagcagcaacagcaacagcaaccACCACTTCATCCACTCATGGGGAAGCGCCCCCGTTCCGATTACGATATGCCTGGTGGGCCAGGGCGTGACTTGCCTAGCTATTTTCCTCACGAGGGCGAAAGAGGAAATCACTTAGTGGTTAAAGATTCTGATACAATCGGTGCATCTTACGACCGTTACCTACGTGGCACACAACAGCAATTGCCACCATA...

CDS

Download CDS FASTA

1512 bp · LXL04_021574|LXL04_021574|OH1004|CDS

ATGGCCGATTCTTACTGGAAATATGCTGCCGCTGACGGTAGGCAGCAGCAGCAACAGCAACAGCAACCACCACTTCATCCACTCATGGGGAAGCGCCCCCGTTCCGATTACGATATGCCTGGTGGGCCAGGGCGTGACTTGCCTAGCTATTTTCCTCACGAGGGCGAAAGAGGAAATCACTTAGTGGTTAAAGATTCTGATACAATCGGTGCATCTTACGACCGTTACCTACGTGGCACACAACAGCAATTGCCACCATA...

Protein

Download Protein FASTA

503 aa · LXL04_021574|LXL04_021574|OH1004|PROTEIN

MADSYWKYAAADGRQQQQQQQQPPLHPLMGKRPRSDYDMPGGPGRDLPSYFPHEGERGNHLVVKDSDTIGASYDRYLRGTQQQLPPYGGGMEPARPPMSMGLGPIGGRFHEDSRMMGMVDPTIGKGREAGLLGPRHEIPLPPDASNTLFVEGLPSNCSRREVAHIFRPFVGYKEARLVTKESRHSSGDPLVLCFVDFKSPAEAATAKDALQGYKFDEHDRDSVCLRLQFARYPGVRAGGGGGGGGGGKPGGANRGRRILS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021574`
TK1151 ID	TkA05G407500
OH-1004 ID	LXL04_021574
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 51.093 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021574

Location Chr04:132599114-132607440 (-)

Description Similar to At4g27700: Rhodanese-like domain-containing protein 14, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27700`	Rhodanese-like domain-containing protein 14, chloroplastic.	No verified direct reference in this release
`At1g21320`	Alternative splicing (AS) regulator that binds to specific mRNAs and modulates auxin effects on the transcriptome.	No verified direct reference in this release
`At1g76940`	Alternative splicing (AS) regulator that binds to specific mRNAs and modulates auxin effects on the transcriptome.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021574 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G21320

ath:AT1G76940

ath:AT4G27700

mtr:11424149

mtr:25496067

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.861

Rank 1 · LXL04_021574 · OH-1004

Nucleus0.113

Rank 2 · LXL04_021574 · OH-1004

Mitochondrion0.071

Rank 3 · LXL04_021574 · OH-1004

Cytoplasm0.036

Rank 4 · LXL04_021574 · OH-1004

Cell membrane0.019

Rank 5 · LXL04_021574 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_1148-218 aa

PF00581.26Rhodanese361-494 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021574	`PF00076.29`	RRM_1	148	218	3e-11	43.7
LXL04_021574	`PF00581.26`	Rhodanese	361	494	1.5e-14	55.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94A65`	Arabidopsis thaliana	Rhodanese-like domain-containing protein 14, chloroplastic	65.801%	Swiss-Prot	weak database homology
`F4HWF9`	Arabidopsis thaliana	Nuclear speckle RNA-binding protein B	50.467%	Swiss-Prot	weak database homology
`A1A6K6`	Arabidopsis thaliana	Nuclear speckle RNA-binding protein A	73.529%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card