TkA05G407500 | RubberDandelionOmics

Gene overview

TkA05G407500

Reference: TK1151 Chr: Chr05 Coordinates: 101318236-101326981 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1741 bp · TkA05G407500|TK1151|cDNA

TAAAAAGAAACCAAATTTCATATATGTCCAATAAAGACCCAAAAAGAAAACAAAATTCCAAAATCTACCAAACGAGGTCTCAATTCTCAATCAACAAGAAGATATAAATCCAAAGACCGAACGACTGTAACTCTTTTTTTCGTTTCTTCTCGTGTCTTTCCGGCCATCAGAACGCCGTAATCCGGCTGCTTTTCTGATTTCAATTTTCCATCACTGATAACAACAACATGGCCGATTCTTACTGGAAATATGCTGCCGCT...

CDS

Download CDS FASTA

774 bp · TkA05G407500|TK1151|CDS

ATGGCCGATTCTTACTGGAAATATGCTGCCGCTGACGGTAGGCAGCAGCAGCAACAGCAACAGCAACCACCACTTCATCCACTCATGGGGAAGCGCCCCCGTTCCGATTACGATATGCCTGGTGGGCCAGGGCGTGACTTGCCTAGCTATTTTCCTCACGAGGGCGAAAGAGGAAATCACTTAGTGGTTAAAGATTCTGATACTATCGGTGCATCTTACGACCGTTACCTACGTGGCACACAACAGCAATTGCCACCATA...

Protein

Download Protein FASTA

257 aa · TkA05G407500|TK1151|PROTEIN

MADSYWKYAAADGRQQQQQQQQPPLHPLMGKRPRSDYDMPGGPGRDLPSYFPHEGERGNHLVVKDSDTIGASYDRYLRGTQQQLPPYGGGMEPARPPMSMGLGPIGGRFHEDSRMMGMVDPTIGKGREAGLLGPRHEIPLPPDASNTLFVEGLPSNCSRREVAHIFRPFVGYKEARLVTKESRHSSGDPLVLCFVDFKSPAEAATAKDALQGYKFDEHDRDSVCLRLQFARYPGVRAGGGGGGGGGGKPGGANRGRR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G407500`
TK1151 ID	TkA05G407500
OH-1004 ID	LXL04_021574
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 51.093 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G407500

Location Chr05:101318236-101326981 (-)

Description Similar to At4g27700: Rhodanese-like domain-containing protein 14, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27700`	Rhodanese-like domain-containing protein 14, chloroplastic.	No verified direct reference in this release
`At1g21320`	Alternative splicing (AS) regulator that binds to specific mRNAs and modulates auxin effects on the transcriptome.	No verified direct reference in this release
`At1g76940`	Alternative splicing (AS) regulator that binds to specific mRNAs and modulates auxin effects on the transcriptome.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021574 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G21320

ath:AT1G76940

ath:AT4G27700

mtr:11424149

mtr:25496067

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.976

Rank 1 · TkA05G407500 · TK1151

Cytoplasm0.111

Rank 2 · TkA05G407500 · TK1151

Cell membrane0.022

Rank 3 · TkA05G407500 · TK1151

Endoplasmic reticulum0.016

Rank 4 · TkA05G407500 · TK1151

Plastid0.008

Rank 5 · TkA05G407500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24099RBD_DGKtheta147-198 aa

PF00076RRM_1148-218 aa

PF26763Whi3-like_N148-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G407500	`PF24099`	RBD_DGKtheta	147	198	0.25	12.2
TkA05G407500	`PF00076`	RRM_1	148	218	1.1e-11	45.1
TkA05G407500	`PF26763`	Whi3-like_N	148	211	0.11	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94A65`	Arabidopsis thaliana	sp\|Q94A65\|STR14_ARATH Rhodanese-like domain-containing protein 14, chloroplastic	77.700%	Swiss-Prot	High
`F4HWF9`	Arabidopsis thaliana	sp\|F4HWF9\|NSRB_ARATH Nuclear speckle RNA-binding protein B	50.500%	Swiss-Prot	High
`A1A6K6`	Arabidopsis thaliana	sp\|A1A6K6\|NSRA_ARATH Nuclear speckle RNA-binding protein A	46.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card