LXL04_021500 | RubberDandelionOmics

Gene overview

LXL04_021500

Reference: OH-1004 Chr: Chr04 Coordinates: 131287735-131289341 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1287 bp · LXL04_021500|LXL04_021500|OH1004|cDNA

ATGGCGTCGGTGTTTTTGTATCACGTGGTGGGGGATCTGACGGTGGGGAAGCCGGAGCTGGTTGAGTTCACCGAGAATGAGACGCTCGAGGCTGCGATTAAGGCGATCGGAGAGTCGACGGAGTGCGGGATAGCAGTTTGGAAGAGGAGGTCGGTGCAGAAGGGTTTAATCGAGAACGCAGAAACGAGGCATCAGAGGTTTGTGGGTATCTTAAATCCGCTCGATATCGTTGCTTTCTTAGCAAGAGATGAGTGTTTGAA...

CDS

Download CDS FASTA

1287 bp · LXL04_021500|LXL04_021500|OH1004|CDS

ATGGCGTCGGTGTTTTTGTATCACGTGGTGGGGGATCTGACGGTGGGGAAGCCGGAGCTGGTTGAGTTCACCGAGAATGAGACGCTCGAGGCTGCGATTAAGGCGATCGGAGAGTCGACGGAGTGCGGGATAGCAGTTTGGAAGAGGAGGTCGGTGCAGAAGGGTTTAATCGAGAACGCAGAAACGAGGCATCAGAGGTTTGTGGGTATCTTAAATCCGCTCGATATCGTTGCTTTCTTAGCAAGAGATGAGTGTTTGAA...

Protein

Download Protein FASTA

428 aa · LXL04_021500|LXL04_021500|OH1004|PROTEIN

MASVFLYHVVGDLTVGKPELVEFTENETLEAAIKAIGESTECGIAVWKRRSVQKGLIENAETRHQRFVGILNPLDIVAFLARDECLNDQEKALKTPVSKVVVPDNSLMKEVDPGTRLIDALEIMKHGVRRLLVPKSIGWRGMSKRFSILYNGKWLKNIDSNPNLTIPNINRTSSSTTTTPTATTTILRDKFCCLSREDVIRFLIGCLGALAPLPLSSISSLGAINPNYFSIEASSPAIDAAREIPREPSAFAVVDPTPDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021500`
TK1151 ID	TkA05G400870
OH-1004 ID	LXL04_021500
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021500

Location Chr04:131287735-131289341 (+)

Description Similar to CBSX6: CBS domain-containing protein CBSX6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65320`	CBS domain-containing protein CBSX6.	No verified direct reference in this release
`At4g27460`	CBS domain-containing protein CBSX5.	No verified direct reference in this release
`At1g80090`	Plays redundant role with PV42a in regulating male gametogenesis and pollen tube guidance.	AtPV42a and AtPV42b redundantly regulate reproductive development in Arabidopsis thaliana.2011 · DOI: 10.1371/journal.pone.0019033

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021500 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0003006 developmental process involved in reproduction Biological Process

GO:0009553 embryo sac development Biological Process

GO:0009555 pollen development Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0048443 stamen development Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

KEGG gene cross-reference

ath:AT1G65320

ath:AT1G80090

ath:AT4G27460

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.344

Rank 1 · LXL04_021500 · OH-1004

Cytoplasm0.320

Rank 2 · LXL04_021500 · OH-1004

Cell membrane0.243

Rank 3 · LXL04_021500 · OH-1004

Lysosome / Vacuole0.065

Rank 4 · LXL04_021500 · OH-1004

Endoplasmic reticulum0.065

Rank 5 · LXL04_021500 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZA4`	Arabidopsis thaliana	CBS domain-containing protein CBSX6	65.952%	Swiss-Prot	strong database homology
`Q84WQ5`	Arabidopsis thaliana	CBS domain-containing protein CBSX5	25.829%	Swiss-Prot	weak database homology
`Q8GXI9`	Arabidopsis thaliana	SNF1-related protein kinase regulatory subunit gamma-like PV42b	22.378%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card