LXL04_011141 | RubberDandelionOmics

Gene overview

LXL04_011141

Reference: OH-1004 Chr: Chr02 Coordinates: 158886968-158899320 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6765 bp · LXL04_011141|LXL04_011141|OH1004|cDNA

ATGGCAGTAGCTCTGTTTAGCAGTCCTTTAGGGAGGGAGTACCATGGAAACAGCAAAATGGAAGGGATGAAGCTTACAGGAAGGAGACGAGTTTTTGTCCAAACAGAATCCGGTTGTGTTTTAGGAATGGAGCTAGATCGATCCGATAACGCCCACACAGTCAAACGAAGGTTACAAGTTGCTCTCAGTTTACCAATTGAAGAATCCTCATTGACTTTTGGCGACATGGTTTTAAACAACGACCTCAGTGCCATTCGCAA...

CDS

Download CDS FASTA

6765 bp · LXL04_011141|LXL04_011141|OH1004|CDS

ATGGCAGTAGCTCTGTTTAGCAGTCCTTTAGGGAGGGAGTACCATGGAAACAGCAAAATGGAAGGGATGAAGCTTACAGGAAGGAGACGAGTTTTTGTCCAAACAGAATCCGGTTGTGTTTTAGGAATGGAGCTAGATCGATCCGATAACGCCCACACAGTCAAACGAAGGTTACAAGTTGCTCTCAGTTTACCAATTGAAGAATCCTCATTGACTTTTGGCGACATGGTTTTAAACAACGACCTCAGTGCCATTCGCAA...

Protein

Download Protein FASTA

2254 aa · LXL04_011141|LXL04_011141|OH1004|PROTEIN

MAVALFSSPLGREYHGNSKMEGMKLTGRRRVFVQTESGCVLGMELDRSDNAHTVKRRLQVALSLPIEESSLTFGDMVLNNDLSAIRNDSPLLLTRNILHRSSSTPCLSPTGRDLHQKDQSGPVEIIGGRSSNFARTKPLVDEVVTAIKTGVDPVPVNGGLGGAYYFKNCRGESVAIVKPTDEEPFAPNNPKGFVGKALGQPGLKRSVRVGETGFREVAAYLLDYDHFANVPPTALVKITHSIFNINDSVSNNNNNNKKKN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011141`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011141

Location Chr02:158886968-158899320 (+)

Description Similar to PI4KG7: Phosphatidylinositol 4-kinase gamma 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03890`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3) (By similarity).	Characterization of a new family of protein kinases from Arabidopsis containing phosphoinositide 3/4-kinase and ubiquitin-like domains.2008 · DOI: 10.1042/bj20070959
`At1g13640`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release
`At1g26270`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release
`At2g40850`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release
`At3g56600`	The phosphorylation of phosphatidylinositol (PI) to PI4P is the first committed step in the generation of phosphatidylinositol 4,5-bisphosphate (PIP2), a precursor of the second messenger inositol 1,4,5-trisphosphate (InsP3).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011141 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0046777 protein autophosphorylation Biological Process

GO:0046854 phosphatidylinositol phosphate biosynthetic process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0004430 1-phosphatidylinositol 4-kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0043424 protein histidine kinase binding Molecular Function

KEGG gene cross-reference

ath:AT1G13640

ath:AT1G26270

ath:AT2G03890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.531

Rank 1 · LXL04_011141 · OH-1004

Nucleus0.512

Rank 2 · LXL04_011141 · OH-1004

Cell membrane0.062

Rank 3 · LXL04_011141 · OH-1004

Mitochondrion0.059

Rank 4 · LXL04_011141 · OH-1004

Endoplasmic reticulum0.051

Rank 5 · LXL04_011141 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00454.34PI3_PI4_kinase161-421 aa

PF00454.34PI3_PI4_kinase1030-1289 aa

PF14291.12DUF43711648-1883 aa

PF27073.1FAM200-ZBED5_RNase-like1799-1888 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011141	`PF00454.34`	PI3_PI4_kinase	161	421	4.2e-90	302.6
LXL04_011141	`PF00454.34`	PI3_PI4_kinase	1030	1289	4.2e-90	302.6
LXL04_011141	`PF14291.12`	DUF4371	1648	1883	1.5e-106	356.0
LXL04_011141	`PF27073.1`	FAM200-ZBED5_RNase-like	1799	1888	8.6e-11	42.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SI52`	Arabidopsis thaliana	Phosphatidylinositol 4-kinase gamma 7	62.389%	Swiss-Prot	weak database homology
`Q8W4R8`	Arabidopsis thaliana	Phosphatidylinositol 4-kinase gamma 6	64.062%	Swiss-Prot	weak database homology
`Q9C671`	Arabidopsis thaliana	Phosphatidylinositol 4-kinase gamma 5	61.444%	Swiss-Prot	weak database homology
`O22199`	Arabidopsis thaliana	Phosphatidylinositol 4-kinase gamma 1	41.869%	Swiss-Prot	weak database homology
`Q0WMZ6`	Arabidopsis thaliana	Phosphatidylinositol 4-kinase gamma 8	41.098%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card