LXL04_001700 | RubberDandelionOmics

Gene overview

LXL04_001700

Reference: OH-1004 Chr: Chr01 Coordinates: 31528832-31532740 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1131 bp · LXL04_001700|LXL04_001700|OH1004|cDNA

ATGTCTGTTGCCGAGCTAAAAGAGAGGCACATGGCTGCTACAGAAACTCTGAATTCTCTCAGGGAACGATTAAAAGAAAGACGACTTCAACTTCTCGATACAGACGTGGCGGGTTATGCAAGAGCACAAGGTAAGACTGCGGTTGCTCTCGGCCCGATGGATCTAGTTTGTTGTCGGATTTTACAGGGACACACTGGCAAGGTATATTCACTAGACTGGACACCCGAAAAGAACCGCATAGTAAGCGCATCACAAGACGG...

CDS

Download CDS FASTA

1131 bp · LXL04_001700|LXL04_001700|OH1004|CDS

ATGTCTGTTGCCGAGCTAAAAGAGAGGCACATGGCTGCTACAGAAACTCTGAATTCTCTCAGGGAACGATTAAAAGAAAGACGACTTCAACTTCTCGATACAGACGTGGCGGGTTATGCAAGAGCACAAGGTAAGACTGCGGTTGCTCTCGGCCCGATGGATCTAGTTTGTTGTCGGATTTTACAGGGACACACTGGCAAGGTATATTCACTAGACTGGACACCCGAAAAGAACCGCATAGTAAGCGCATCACAAGACGG...

Protein

Download Protein FASTA

376 aa · LXL04_001700|LXL04_001700|OH1004|PROTEIN

MSVAELKERHMAATETLNSLRERLKERRLQLLDTDVAGYARAQGKTAVALGPMDLVCCRILQGHTGKVYSLDWTPEKNRIVSASQDGRLIVWNALTSQKTHAIKLPCAWVMTCAFSPTGQSVACGGLDSICSIFNLSSPLDKDGNIPVSRTLTGHKGYVSACQYLPDDDSRLITASGDQTCVLWDISTGLRASVFGGEFQSGHTADVLSVSINGANSRVFVSGSCDGTARLWDMRVASRAVRTFHGHDGDVNSVRFFPDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_001700`
TK1151 ID	TkA01G518240
OH-1004 ID	LXL04_001700
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 70.745 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_001700`
Location	Chr01:31528832-31532740 (-)
Description	Similar to Guanine nucleotide-binding protein subunit beta-2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001700` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0007165 signal transduction Biological Process GO:0007186 G protein-coupled receptor signaling pathway Biological Process GO:0005737 cytoplasm Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005834 heterotrimeric G-protein complex Cellular Component GO:0005886 plasma membrane Cellular Component GO:0030159 signaling receptor complex adaptor activity Molecular Function
KEGG gene cross-reference	nta:107760597 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.511

Rank 1 · LXL04_001700 · OH-1004

Nucleus0.425

Rank 2 · LXL04_001700 · OH-1004

Lysosome / Vacuole0.087

Rank 3 · LXL04_001700 · OH-1004

Cell membrane0.069

Rank 4 · LXL04_001700 · OH-1004

Golgi apparatus0.061

Rank 5 · LXL04_001700 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24797.2Beta-prop_WDR35_TULP_N44-96 aa

PF25391.2WD40_Gbeta49-367 aa

PF24105.2Beta-prop_CAF1B_HIR156-138 aa

PF00400.39WD4057-93 aa

PF25175.2Beta-prop_WDR557-137 aa

PF24807.2WD40_CDC20-Fz57-189 aa

PF25168.2Beta-prop_WDR36-Utp21_2nd57-130 aa

PF25172.2Beta-prop_WDR3_2nd57-135 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_001700	`PF24797.2`	Beta-prop_WDR35_TULP_N	44	96	8.3e-09	35.7
LXL04_001700	`PF25391.2`	WD40_Gbeta	49	367	4.5e-103	345.5
LXL04_001700	`PF24105.2`	Beta-prop_CAF1B_HIR1	56	138	9.1e-28	98.0
LXL04_001700	`PF00400.39`	WD40	57	93	3.9e-53	176.3
LXL04_001700	`PF25175.2`	Beta-prop_WDR5	57	137	1.4e-51	176.2
LXL04_001700	`PF24807.2`	WD40_CDC20-Fz	57	189	5.3e-34	118.6
LXL04_001700	`PF25168.2`	Beta-prop_WDR36-Utp21_2nd	57	130	1.1e-21	78.3
LXL04_001700	`PF25172.2`	Beta-prop_WDR3_2nd	57	135	3.4e-20	73.2
LXL04_001700	`PF25173.2`	Beta-prop_WDR3_1st	59	137	1.9e-43	149.1
LXL04_001700	`PF23381.2`	Beta-prop_IFT122_1st	59	128	3.3e-43	148.7
LXL04_001700	`PF30552.1`	CFAP251_N	59	304	1.2e-07	31.9
LXL04_001700	`PF24814.2`	WD40_Prp19	60	138	1.3e-38	133.4
LXL04_001700	`PF24817.2`	WD40_WDHD1_1st	60	104	5.3e-31	108.6
LXL04_001700	`PF25174.2`	Beta-prop_THOC3	61	136	1.2e-48	166.2
LXL04_001700	`PF24805.2`	EIF3I	61	123	5.2e-26	92.3
LXL04_001700	`PF23775.2`	Beta-prop_RIG_2nd	61	126	1.7e-11	44.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card