LXL04_000570 | RubberDandelionOmics

Gene overview

LXL04_000570

Reference: OH-1004 Chr: Chr01 Coordinates: 10417748-10420735 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2533 bp · LXL04_000570|LXL04_000570|OH1004|cDNA

ATGGCGTCCTTCGCCGCCGGCTCGGGGCAATTCCTCAGCCTCCATCCAACTCGCTCCCGCTCCCGCTCCCGTTCAAAATTACCCCGTACTTCGTCATCTGCCTCTATAACCACCAACACTATCAGATGCGAACAAATTTCGTCTCAAAACCCTAACAAACCCTCAAACACCCGGCATTCGAATTCGCCCTTGACTTCCATTAAGAATCTAGCTATATCCGCCGCGCCCTTGTTGTCCTTTAAGAATCTAGCTATCTCCGC...

CDS

Download CDS FASTA

2457 bp · LXL04_000570|LXL04_000570|OH1004|CDS

ATGGCGTCCTTCGCCGCCGGCTCGGGGCAATTCCTCAGCCTCCATCCAACTCGCTCCCGCTCCCGCTCCCGTTCAAAATTACCCCGTACTTCGTCATCTGCCTCTATAACCACCAACACTATCAGATGCGAACAAATTTCGTCTCAAAACCCTAACAAACCCTCAAACACCCGGCATTCGAATTCGCCCTTGACTTCCATTAAGAATCTAGCTATATCCGCCGCGCCCTTGTTGTCCTTTAAGAATCTAGCTATCTCCGC...

Protein

Download Protein FASTA

818 aa · LXL04_000570|LXL04_000570|OH1004|PROTEIN

MASFAAGSGQFLSLHPTRSRSRSRSKLPRTSSSASITTNTIRCEQISSQNPNKPSNTRHSNSPLTSIKNLAISAAPLLSFKNLAISAAAGVLFHVAYKNPNLIGIGGGGGGGGAGGGGGGGGGGGGGGEFWKRLLSPAANADENQSPEWDSHGLPADILVPLNKLSGFKKYKLSAIEFLDKVKSMVVGSEDSFFEMVSLRAGGVYTKAQLQKELETLATCGMFEKVDLEAKTNPDGTIGLTVSFTESTWEEAENFRCINV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_000570`
TK1151 ID	TkA01G602300
OH-1004 ID	LXL04_000570
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 85.385 / OH-1004 27.139 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_000570

Location Chr01:10417748-10420735 (+)

Description Similar to TOC75-3: Protein TOC75-3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46740`	Essential protein.	A molecular-genetic study of the Arabidopsis Toc75 gene family.2005 · DOI: 10.1104/pp.105.063289
`At4g09080`	Mediates the insertion of proteins targeted to the outer membrane of chloroplasts.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0271200`	Mediates the insertion of proteins targeted to the outer membrane of chloroplasts.	No verified direct reference in this release
`UniProt: A2X208`	Outer envelope protein 80, chloroplastic.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000570 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009662 etioplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0045036 protein targeting to chloroplast Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0048598 embryonic morphogenesis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009707 chloroplast outer membrane Cellular Component

KEGG gene cross-reference

ath:AT3G46740

ath:AT4G09080

dosa:Os03g0271200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.975

Rank 1 · LXL04_000570 · OH-1004

Mitochondrion0.031

Rank 2 · LXL04_000570 · OH-1004

Cytoplasm0.015

Rank 3 · LXL04_000570 · OH-1004

Nucleus0.014

Rank 4 · LXL04_000570 · OH-1004

Cell membrane0.012

Rank 5 · LXL04_000570 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25282.1POTRA1_3_Toc75156-246 aa

PF25280.2POTRA2_Toc75255-365 aa

PF25282.1POTRA1_3_Toc75366-447 aa

PF01103.30Omp85486-818 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_000570	`PF25282.1`	POTRA1_3_Toc75	156	246	6.3e-60	200.3
LXL04_000570	`PF25280.2`	POTRA2_Toc75	255	365	2.5e-52	176.5
LXL04_000570	`PF25282.1`	POTRA1_3_Toc75	366	447	6.3e-60	200.3
LXL04_000570	`PF01103.30`	Omp85	486	818	2.4e-18	67.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STE8`	Arabidopsis thaliana	Protein TOC75-3, chloroplastic	82.174%	Swiss-Prot	strong database homology
`Q5IZC8`	Arabidopsis thaliana	Protein TOC75-4, chloroplastic	63.373%	Swiss-Prot	moderate database homology
`Q84Q83`	Oryza sativa subsp. japonica	Protein TOC75, chloroplastic	71.655%	Swiss-Prot	strong database homology
`A2X208`	Oryza sativa subsp. indica	Outer envelope protein 80, chloroplastic	24.764%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card