TkA01G602300 | RubberDandelionOmics

Gene overview

TkA01G602300

Reference: TK1151 Chr: Chr01 Coordinates: 151748615-151751920 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2838 bp · TkA01G602300|TK1151|cDNA

TGTAAATCTCGTCCGGTTCAAGCGAGTAATCTGGACTCACCTACTCACTCATAAACCCCTTCCTCTCTCTAGCTCTTATCTCCAATGGCGTCCTTCGCCGCCGGCTCGGGGCAATTCCTCAGCCTCATCCAACTCGCTCCCGCTCCCGCTCCCGCTCCGTTCAAAATTACCCCGTACTTCGTCATCTGCCTCTATACCACCAACACTATCAGATGCGAACAAATTTCGTCTCAAAACCCTAACAAACCCTCAAACACCCG...

CDS

Download CDS FASTA

783 bp · TkA01G602300|TK1151|CDS

ATGGAGGAAATAACAACACGCGATGAAAGCAGTCACATTTCTTCAAACGGTCAACGGGTTTTGCCAAGTGGCGGGATCAGTGCGGATGGCCCACCAACAACACTGAGTGGAACGGGTATTGACCGGATGGTATTCGCACAAGCAAATATTACACGAGACAACACCAAGTTTGTAAACGGTGCAATTGTGGGAGAAAGGAATGTGTTTCAGGTGGATCAAGGGCTGGGGATCGGGAGTAAGTTTCCGTTTTTCAACCGACA...

Protein

Download Protein FASTA

260 aa · TkA01G602300|TK1151|PROTEIN

MEEITTRDESSHISSNGQRVLPSGGISADGPPTTLSGTGIDRMVFAQANITRDNTKFVNGAIVGERNVFQVDQGLGIGSKFPFFNRHQLTLTKFIQLKEVEEGAGKSPPPVLVLHGHYGGCVGDLPSYDAFTLGGPYSVRGYNMGEIGAARNILEVAAEIRVPVRNTHVYAFAEHGNDLGSSKDVKGNPTEVYRRMGQGSSYGVGAKLGLVRAEYAVDHNSGLVLCFSGLERDFELDFCFTILVFVAILFFAISVDGYLT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G602300`
TK1151 ID	TkA01G602300
OH-1004 ID	LXL04_000570
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 85.385 / OH-1004 27.139 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G602300

Location Chr01:151748615-151751920 (-)

Description Similar to TOC75-3: Protein TOC75-3, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46740`	Essential protein.	A molecular-genetic study of the Arabidopsis Toc75 gene family.2005 · DOI: 10.1104/pp.105.063289
`At4g09080`	Mediates the insertion of proteins targeted to the outer membrane of chloroplasts.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0271200`	Mediates the insertion of proteins targeted to the outer membrane of chloroplasts.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000570 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009662 etioplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0045036 protein targeting to chloroplast Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0048598 embryonic morphogenesis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009707 chloroplast outer membrane Cellular Component

KEGG gene cross-reference

ath:AT3G46740

ath:AT4G09080

dosa:Os03g0271200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.630

Rank 1 · TkA01G602300 · TK1151

Lysosome / Vacuole0.127

Rank 2 · TkA01G602300 · TK1151

Cytoplasm0.092

Rank 3 · TkA01G602300 · TK1151

Endoplasmic reticulum0.077

Rank 4 · TkA01G602300 · TK1151

Mitochondrion0.061

Rank 5 · TkA01G602300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01103Omp8518-216 aa

PF03865ShlB124-151 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G602300	`PF01103`	Omp85	18	216	5.5e-14	53.1
TkA01G602300	`PF03865`	ShlB	124	151	0.018	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STE8`	Arabidopsis thaliana	sp\|Q9STE8\|TC753_ARATH Protein TOC75-3, chloroplastic	89.200%	Swiss-Prot	High
`Q5IZC8`	Arabidopsis thaliana	sp\|Q5IZC8\|TC754_ARATH Protein TOC75-4, chloroplastic	76.000%	Swiss-Prot	High
`Q84Q83`	Oryza sativa subsp. japonica	sp\|Q84Q83\|TOC75_ORYSJ Protein TOC75, chloroplastic	76.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card