TkAUNG094400 | RubberDandelionOmics

Gene overview

TkAUNG094400

Reference: TK1151 Chr: ChrUn Coordinates: 26681037-26685127 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1387 bp · TkAUNG094400|TK1151|cDNA

CTGGAAATAGCAAAAAACATGAATGGGCAAATGGCTACTCTATCGCATTATGCTCCCCCTTCCTCAAAAATCACCATTACAGGCAAATTGAGGACTCGTAGATTAATCAATTGTGCTGTCAGAAGCAACTGTGGTAAGCAAATTTCAGGATTTAGGATCGGTGCGGCTGTAACAATGTCGATGGAGAATAAGAAGAAGAAGGAAGTCTGGATATGGACGGAGAACAAGCAGGTTATGACGGCAGCGGTTGAAAGAGGTTG...

CDS

Download CDS FASTA

1350 bp · TkAUNG094400|TK1151|CDS

ATGAATGGGCAAATGGCTACTCTATCGCATTATGCTCCCCCTTCCTCAAAAATCACCATTACAGGCAAATTGAGGACTCGTAGATTAATCAATTGTGCTGTCAGAAGCAACTGTGGTAAGCAAATTTCAGGATTTAGGATCGGTGCGGCTGTAACAATGTCGATGGAGAATAAGAAGAAGAAGGAAGTCTGGATATGGACGGAGAACAAGCAGGTTATGACGGCAGCGGTTGAAAGAGGTTGGAACACGTTCATCTTCTC...

Protein

Download Protein FASTA

449 aa · TkAUNG094400|TK1151|PROTEIN

MNGQMATLSHYAPPSSKITITGKLRTRRLINCAVRSNCGKQISGFRIGAAVTMSMENKKKKEVWIWTENKQVMTAAVERGWNTFIFSSIHRQLATDWSSIALINPIFIEDKSLFDNEAKLVATISEISSPQQLEQLQPDNEHADNVIVDLLDWQVIPAENIVAAFHGTHKTVFAISKGLSEAQVFLEALEQGLGGVVLKTEDTQAVFQLKVYTFFFIHKISLVTHAFLHSFTTILYQEYFDKRNIEGSLLDLTKATINRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG094400`
TK1151 ID	TkAUNG094400
OH-1004 ID	LXL04_006267
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	88.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG094400`
Location	ChrUn:26681037-26685127 (+)
Description	Similar to aroB': 3-dehydroquinate synthase (Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006267` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0008652 amino acid biosynthetic process Biological Process GO:0009073 aromatic amino acid family biosynthetic process Biological Process GO:0003856 3-dehydroquinate synthase activity Molecular Function GO:0051287 NAD binding Molecular Function GO:0102042 dehydroquinate synthase activity Molecular Function
KEGG gene cross-reference	mja:MJ_1249 mmq:MmarC5_1678 mst:Msp_0090 mth:MTH_580 mtp:Mthe_0539 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.960

Rank 1 · TkAUNG094400 · TK1151

Mitochondrion0.058

Rank 2 · TkAUNG094400 · TK1151

Cytoplasm0.045

Rank 3 · TkAUNG094400 · TK1151

Peroxisome0.029

Rank 4 · TkAUNG094400 · TK1151

Nucleus0.026

Rank 5 · TkAUNG094400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01959DHQS60-211 aa

PF31208McdB_C174-200 aa

PF22287TraI-like_C246-272 aa

PF26558DHQS_2nd255-427 aa

PF01189Methyltr_RsmB-F321-354 aa

PF01959DHQS334-398 aa

PF22287TraI-like_C334-352 aa

PF22287TraI-like_C377-421 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG094400	`PF01959`	DHQS	60	211	3.2e-44	151.4
TkAUNG094400	`PF31208`	McdB_C	174	200	0.094	13.2
TkAUNG094400	`PF22287`	TraI-like_C	246	272	0.25	12.0
TkAUNG094400	`PF26558`	DHQS_2nd	255	427	1.6e-70	236.8
TkAUNG094400	`PF01189`	Methyltr_RsmB-F	321	354	0.03	14.7
TkAUNG094400	`PF01959`	DHQS	334	398	3.2e-44	151.4
TkAUNG094400	`PF22287`	TraI-like_C	334	352	0.25	12.0
TkAUNG094400	`PF22287`	TraI-like_C	377	421	0.25	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card