Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1335 bp · LXL04_006267|LXL04_006267|OH1004|cDNA
ATGAATGGGCAAATGGCTACTCTATCGCATTATGCTCCCCCTTCCTCAAAAATCACCATTACAGGCAAATTGAGGACACGTAGATTAATCAATTGTGCTGTCAGAAGCAACTGTGGTAAGCAAATTTCAGGATTTAGGATCGGTGCGGCTGTAACAATGTTGATGGAgaataagaagaagaaggaagtcTGGATATGGACGGAGAACAAGCAGGTTATGACGGCAGCTGTTGAAAGAGGCTGGAACACGTTCATCTTCTC...
1335 bp · LXL04_006267|LXL04_006267|OH1004|CDS
ATGAATGGGCAAATGGCTACTCTATCGCATTATGCTCCCCCTTCCTCAAAAATCACCATTACAGGCAAATTGAGGACACGTAGATTAATCAATTGTGCTGTCAGAAGCAACTGTGGTAAGCAAATTTCAGGATTTAGGATCGGTGCGGCTGTAACAATGTTGATGGAGAATAAGAAGAAGAAGGAAGTCTGGATATGGACGGAGAACAAGCAGGTTATGACGGCAGCTGTTGAAAGAGGCTGGAACACGTTCATCTTCTC...
Protein
Download Protein FASTA444 aa · LXL04_006267|LXL04_006267|OH1004|PROTEIN
MNGQMATLSHYAPPSSKITITGKLRTRRLINCAVRSNCGKQISGFRIGAAVTMLMENKKKKEVWIWTENKQVMTAAVERGWNTFIFSSIDRQLATDWSSIALINPIFIEDKSLFDNEAKLVATISVISSPQQLEQLQPDNEHADNVIVDLLDWQVIPAENIVAAFHGTHKTVFAISKGLSEAQVFLEALEQGLGGVVLKTEDTQAVFQLKEYFDKRNIEGSLLDLTKATITRVQTSGMGDRVCVDLCSLMRPGEGLLVGS...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_006267 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_006267 |
|---|---|
| Location | Chr02:5565407-5569317 (+) |
| Description | Similar to aroB': 3-dehydroquinate synthase (Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0008652 amino acid biosynthetic process Biological Process GO:0009073 aromatic amino acid family biosynthetic process Biological Process GO:0003856 3-dehydroquinate synthase activity Molecular Function GO:0051287 NAD binding Molecular Function GO:0102042 dehydroquinate synthase activity Molecular Function |
| KEGG gene cross-reference | mja:MJ_1249 mmq:MmarC5_1678 mst:Msp_0090 mth:MTH_580 mtp:Mthe_0539 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01959.22DHQS60-213 aaPF26558.1DHQS_2nd228-291 aaPF26558.1DHQS_2nd310-422 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_006267 | PF01959.22 | DHQS | 60 | 213 | 1.6e-44 | 152.3 |
| LXL04_006267 | PF26558.1 | DHQS_2nd | 228 | 291 | 4.5e-66 | 222.3 |
| LXL04_006267 | PF26558.1 | DHQS_2nd | 310 | 422 | 4.5e-66 | 222.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.