Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2857 bp · TkAUNG092120|TK1151|cDNA
CTCATTTCCTTTCTTTTCCCTCGATAAATTAAACTCGGGAACAAGGTGTAACGGCGCGGGTTACTGGTTAGGACTTAGGACCTCGTAAACATGGAGTGGGTTTTGCAATGGAGTTGCTCTAAGAAACCAGTCCCTCTGTAACCTTTTAGGGCAAACACGATTAACTAACGAGGAAGACGAAGCTGCAAACACATTTCATAACCATTACCCGACCACCATTCGCCGTCGGCAATGATTCCGACCACCAGGCGACCCAAAAC...
2001 bp · TkAUNG092120|TK1151|CDS
ATGGGCTATCTCAATAGAGCGTCCAAAGCAATACAAGTAGCCAATCGCATACACAGACTCAGCTCCAATCATCACCACCACTACAGTTACAGGTTAGGGTTACCTTATTTTAGATCACATGAACACGGATTCTGCTCAAATTCACGGAATAGTAACCGCAAAGACGATAACAATGCCGTAGATTTGAGCCAATACCCTACCGACAAAATTCGAAACTTCTCAATTATTGCTCATGTTGATCATGGAAAATCTACACTCGC...
Protein
Download Protein FASTA666 aa · TkAUNG092120|TK1151|PROTEIN
MGYLNRASKAIQVANRIHRLSSNHHHHYSYRLGLPYFRSHEHGFCSNSRNSNRKDDNNAVDLSQYPTDKIRNFSIIAHVDHGKSTLADRLLELTGTIKRGHGAQYLDKLQVERERGITVKAQTATMFYNYEPKETTSTSYLLNLVDTPGHVDFSYEVSRSLAACQGALLVVDAAQGVQAQTVANFYLAFESNLSIIPIINKIDQPTADPDRVKSQLQSMFDLDPKDVLLTSAKTGQGLEHVIPAVIERIPPPPGNCDSNL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG092120 |
|---|---|
| TK1151 ID | TkAUNG092120 |
| OH-1004 ID | LXL04_019998 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 27.000 |
| Protein coverage (%) | TK1151 64.565 / OH-1004 63.596Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG092120 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | ChrUn:26110131-26114987 (-) | ||||||||||||
| Description | Similar to bipA: 50S ribosomal subunit assembly factor BipA (Helicobacter pylori (strain ATCC 700392 / 26695) | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0000027 ribosomal large subunit assembly Biological Process GO:0006412 translation Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0010467 gene expression Biological Process GO:0005829 cytosol Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0000049 tRNA binding Molecular Function GO:0003924 GTPase activity Molecular Function GO:0005525 GTP binding Molecular Function GO:0019843 rRNA binding Molecular Function GO:0043022 ribosome binding Molecular Function | ||||||||||||
| KEGG gene cross-reference | ecc:c4820 ecj:JW5571 eco:b3871 ecoc:C3026_20930 heo:C694_02460 hpj:jhp_0432 hpy:HP_0480 sfl:SF3941 sfx:S3805 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00009GTP_EFTU69-251 aaPF01926MMR_HSR179-201 aaPF09439SRPRB114-187 aaPF00071Ras134-249 aaPF03170CBM_BcsB_1st147-170 aaPF14492EFG_III207-225 aaPF03144GTP_EFTU_D2274-343 aaPF14492EFG_III362-431 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkAUNG092120 | PF00009 | GTP_EFTU | 69 | 251 | 1e-53 | 182.4 |
| TkAUNG092120 | PF01926 | MMR_HSR1 | 79 | 201 | 0.00047 | 21.0 |
| TkAUNG092120 | PF09439 | SRPRB | 114 | 187 | 0.088 | 12.9 |
| TkAUNG092120 | PF00071 | Ras | 134 | 249 | 0.05 | 13.9 |
| TkAUNG092120 | PF03170 | CBM_BcsB_1st | 147 | 170 | 0.043 | 14.3 |
| TkAUNG092120 | PF14492 | EFG_III | 207 | 225 | 0.00075 | 20.2 |
| TkAUNG092120 | PF03144 | GTP_EFTU_D2 | 274 | 343 | 5.9e-05 | 24.1 |
| TkAUNG092120 | PF14492 | EFG_III | 362 | 431 | 0.00075 | 20.2 |
| TkAUNG092120 | PF16658 | RF3_C | 363 | 432 | 0.013 | 16.0 |
| TkAUNG092120 | PF00679 | EFG_C | 471 | 554 | 3.3e-22 | 79.0 |
| TkAUNG092120 | PF03170 | CBM_BcsB_1st | 531 | 567 | 0.043 | 14.3 |
| TkAUNG092120 | PF06421 | LepA_C | 558 | 664 | 1.3e-49 | 167.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.