TkAUNG087380 | RubberDandelionOmics

Gene overview

TkAUNG087380

Reference: TK1151 Chr: ChrUn Coordinates: 24852892-24858215 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3086 bp · TkAUNG087380|TK1151|cDNA

TTTCACTTCTCTGCCACTAAAACCCCAAATCGCCTTGCAAGGGGTTTTGTTTATTGTCACGCTTCAATGGTGTTTTCCAATACCTCCCTCTTATCCCCTTCTTTATACAAACTCAATCCTGTTCTCTTCTCCCATCGGCGTCGTAGTGTCGTTTTCTCCCGATTTCATCATCGTATTCTTAGACCAAAGTTTACAGTAGCTGCTGCATCAGACAATGGCGTATTTACTTCTCCCGAGATATCAAAATCTTTTGACTTTAC...

CDS

Download CDS FASTA

2505 bp · TkAUNG087380|TK1151|CDS

ATGATCAGATACAACCGGATGAAGGGAAGGCCTACACTTTGGCTCCCTGGTACTGATCATGCTGGCATTGCAACTCAGTTGGTTGTGGAAAGAATGTTAGCTTCTGAAGGAATTAAGAGGGTTGAATTGGGTAGAGAGGAGTTTACAAAACGAGTTTGGGAGTGGAAGGAAAAATATGGAGGAACCATTACAAATCAAATCAGACGACTTGGTGCTTCTTGTGATTGGACCAGAGAACATTTTACACTTGATGAACAACT...

Protein

Download Protein FASTA

834 aa · TkAUNG087380|TK1151|PROTEIN

MIRYNRMKGRPTLWLPGTDHAGIATQLVVERMLASEGIKRVELGREEFTKRVWEWKEKYGGTITNQIRRLGASCDWTREHFTLDEQLSRAVIEAFVKLHEKGLIYQGSYMVNWSPNLQTAVSDLEVEYSEEPGTLYHIKYRVAGGSKSDFLTIATTRPETLFGDTAIAVNPEDERYAKYIGKSAIVPMTFGRHVPIIADKYVDKEFGTGVLKISPGHDHNDYLLARKLGLPILNVMNKDGTLNEVAGLYNGLDRFEARKK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG087380`
TK1151 ID	TkAUNG087380
OH-1004 ID	LXL04_028552
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	38.900
Protein coverage (%)	TK1151 96.043 / OH-1004 82.514 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG087380

Location ChrUn:24852892-24858215 (-)

Description Similar to TWN2: Valine--tRNA ligase, mitochondrial 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g16715`	Valine--tRNA ligase, chloroplastic/mitochondrial 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028552 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006418 tRNA aminoacylation for protein translation Biological Process

GO:0006438 valyl-tRNA aminoacylation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0031012 extracellular matrix Cellular Component

GO:0097225 sperm midpiece Cellular Component

GO:0097228 sperm principal piece Cellular Component

KEGG gene cross-reference

ath:AT1G14610

ddi:DDB_G0277733

hsa:7407

mmu:22321

rno:25009

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.744

Rank 1 · TkAUNG087380 · TK1151

Nucleus0.187

Rank 2 · TkAUNG087380 · TK1151

Plastid0.148

Rank 3 · TkAUNG087380 · TK1151

Mitochondrion0.062

Rank 4 · TkAUNG087380 · TK1151

Peroxisome0.061

Rank 5 · TkAUNG087380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00133tRNA-synt_11-511 aa

PF09334tRNA-synt_1g1-127 aa

PF13603tRNA-synt_1_2139-174 aa

PF13603tRNA-synt_1_2181-241 aa

PF09334tRNA-synt_1g292-525 aa

PF01406tRNA-synt_1e454-517 aa

PF10458Val_tRNA-synt_C514-524 aa

PF00133tRNA-synt_1564-609 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG087380	`PF00133`	tRNA-synt_1	1	511	2.2e-132	442.4
TkAUNG087380	`PF09334`	tRNA-synt_1g	1	127	6.4e-18	65.4
TkAUNG087380	`PF13603`	tRNA-synt_1_2	139	174	8.7e-11	42.4
TkAUNG087380	`PF13603`	tRNA-synt_1_2	181	241	8.7e-11	42.4
TkAUNG087380	`PF09334`	tRNA-synt_1g	292	525	6.4e-18	65.4
TkAUNG087380	`PF01406`	tRNA-synt_1e	454	517	0.0001	22.5
TkAUNG087380	`PF10458`	Val_tRNA-synt_C	514	524	1.9e-15	57.6
TkAUNG087380	`PF00133`	tRNA-synt_1	564	609	2.2e-132	442.4
TkAUNG087380	`PF08264`	Anticodon_1	568	711	1.5e-40	139.2
TkAUNG087380	`PF10458`	Val_tRNA-synt_C	762	826	1.9e-15	57.6
TkAUNG087380	`PF16326`	ABC_tran_CTD	766	817	0.15	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KE63`	Arabidopsis thaliana	sp\|F4KE63\|SYVM2_ARATH Valine--tRNA ligase, chloroplastic/mitochondrial 2	80.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card