TkAUNG081150 | RubberDandelionOmics

Gene overview

TkAUNG081150

Reference: TK1151 Chr: ChrUn Coordinates: 23124350-23126697 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1295 bp · TkAUNG081150|TK1151|cDNA

TGCTACACAAACTTTAACGGTCTGCATGAAAAGTGGCGCCATATTGCTATTAGTTCATAGATATGGGGGCTAAGTGAATAAATATATCATATCTACCTTGATTTTATTGTCTTATTGCGGAAAAGGGGTCTTCCTTTGACTTAACGGTAACGTCATTTTCAGAAAGGCCAAGCAAAACCCTTCTATCTTCGATCTTCGTAAATTTCTGCACCCCAAATCAAATTTGTTTACAGAAATATACCTCAGCAGATCGGATCTGT...

CDS

Download CDS FASTA

651 bp · TkAUNG081150|TK1151|CDS

ATGGGTTGTTTTTGTTCAACTCCTCATAGCTACAGAAAAGCACCTCCCTTTGATCCTGTTGCACTTGCTGCTGAGACTCCTTTTACTGAAAATGAGGTGGAGGCTCTATATGAGCTGTTTGAGAAACTAAGCAGTTCTCTTCATGATGATGGTCTTATAGGGAAGGATGAGTTCCTCCTGGCATTATTCAGGGATCATGGCCAAAGAAACCTGTTTGCAGATAGGATATTTGATCTTTTTGATGTGAATAGAAGTGGGCA...

Protein

Download Protein FASTA

216 aa · TkAUNG081150|TK1151|PROTEIN

MGCFCSTPHSYRKAPPFDPVALAAETPFTENEVEALYELFEKLSSSLHDDGLIGKDEFLLALFRDHGQRNLFADRIFDLFDVNRSGHIDFTEFVRSLGVFHPKAPQADKILYAFKLYDLRRTGFIEREELKEMVSALLKESDLSLSDDIIESMVDKTFTEADTKGDGRIDQEEWKEYVNKNPSLLKNMTLPHLMDITLRFPSFVMNSQVEESHTTD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG081150`
TK1151 ID	TkAUNG081150
OH-1004 ID	LXL04_026643
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG081150

Location ChrUn:23124350-23126697 (-)

Description Similar to CBL4: Calcineurin B-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24270`	May act as a calcium sensor regulating intracellular Na⁺/K⁺ homeostasis and salt tolerance.	The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3.2000 · DOI: 10.1073/pnas.97.7.3735 SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding.2000 · DOI: 10.1105/tpc.12.9.1667 Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3.2002 · DOI: 10.1073/pnas.122224699 Calcium-dependent modulation and plasma membrane targeting of the AKT2 potassium channel by the CBL4/CIPK6 calcium sensor/protein kinase complex.2011 · DOI: 10.1038/cr.2011.50 Arabidopsis SOS3 plays an important role in salt tolerance by mediating calcium-dependent microfilament reorganization.2013 · DOI: 10.1007/s00299-012-1348-3

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0291000`	Acts as a calcium sensor.	No verified direct reference in this release
`Os05g0534400`	Acts as a calcium sensor involved in the regulatory pathway for the control of intracellular Na(+) and K(+) homeostasis and salt tolerance.	Conservation of the salt overly sensitive pathway in rice.2007 · DOI: 10.1104/pp.106.092635
`Os02g0291400`	Acts as a calcium sensor.	Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses.2008 · DOI: 10.1016/j.gene.2008.02.011
`Os10g0564800`	Acts as a calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026643 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005513 detection of calcium ion Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0030007 intracellular potassium ion homeostasis Biological Process

GO:0042539 hypotonic salinity response Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005955 calcineurin complex Cellular Component

GO:0032578 aleurone grain membrane Cellular Component

GO:0004723 calcium-dependent protein serine/threonine phosphatase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G24270

dosa:Os02g0291000

dosa:Os05g0534400

osa:107276173

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.451

Rank 1 · TkAUNG081150 · TK1151

Cytoplasm0.380

Rank 2 · TkAUNG081150 · TK1151

Nucleus0.158

Rank 3 · TkAUNG081150 · TK1151

Lysosome / Vacuole0.115

Rank 4 · TkAUNG081150 · TK1151

Golgi apparatus0.094

Rank 5 · TkAUNG081150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499EF-hand_726-59 aa

PF18870HEPN_RES_NTD129-59 aa

PF12763EH30-94 aa

PF24082SPEF2_C35-59 aa

PF30347RSA-1_C40-57 aa

PF17959EF-hand_1441-57 aa

PF13405EF-hand_646-62 aa

PF13499EF-hand_749-95 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG081150	`PF13499`	EF-hand_7	26	59	3.5e-18	66.4
TkAUNG081150	`PF18870`	HEPN_RES_NTD1	29	59	0.082	14.0
TkAUNG081150	`PF12763`	EH	30	94	0.0011	19.5
TkAUNG081150	`PF24082`	SPEF2_C	35	59	0.12	12.9
TkAUNG081150	`PF30347`	RSA-1_C	40	57	9.4e-06	26.6
TkAUNG081150	`PF17959`	EF-hand_14	41	57	0.028	15.5
TkAUNG081150	`PF13405`	EF-hand_6	46	62	1.7e-17	62.1
TkAUNG081150	`PF13499`	EF-hand_7	49	95	3.5e-18	66.4
TkAUNG081150	`PF00036`	EF-hand_1	50	62	7e-21	72.9
TkAUNG081150	`PF13202`	EF-hand_5	50	58	1.4e-15	56.7
TkAUNG081150	`PF13833`	EF-hand_8	50	95	2.8e-10	40.5
TkAUNG081150	`PF30347`	RSA-1_C	60	139	9.4e-06	26.6
TkAUNG081150	`PF30624`	EF_SSP120	66	94	1.7e-05	26.1
TkAUNG081150	`PF23564`	EF-hand_FSTL1	69	98	2.8e-06	28.4
TkAUNG081150	`PF30624`	EF_SSP120	69	101	1.7e-05	26.1
TkAUNG081150	`PF17959`	EF-hand_14	73	97	0.028	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81223`	Arabidopsis thaliana	sp\|O81223\|CNBL4_ARATH Calcineurin B-like protein 4	69.100%	Swiss-Prot	High
`Q3HRP0`	Oryza sativa subsp. japonica	sp\|Q3HRP0\|CNBL7_ORYSJ Calcineurin B-like protein 7	62.600%	Swiss-Prot	High
`Q75KU4`	Oryza sativa subsp. japonica	sp\|Q75KU4\|CNBL4_ORYSJ Calcineurin B-like protein 4	59.900%	Swiss-Prot	High
`Q3HRN9`	Oryza sativa subsp. japonica	sp\|Q3HRN9\|CNBL8_ORYSJ Calcineurin B-like protein 8	61.100%	Swiss-Prot	High
`Q7XC27`	Oryza sativa subsp. japonica	sp\|Q7XC27\|CNBL1_ORYSJ Calcineurin B-like protein 1	59.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card