LXL04_026643 | RubberDandelionOmics

Gene overview

LXL04_026643

Reference: OH-1004 Chr: Chr06 Coordinates: 805816-807111 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

651 bp · LXL04_026643|LXL04_026643|OH1004|cDNA

ATGGGTTGTTTTTGTTCAACTCCTCATAGCTACAGAAAAGCACCTCCCTTTGATCCTGTTGCACTTGCTGCTGAGACTCCTTTTACTGAAAATGAGGTGGAGGCTCTATATGAGCTGTTTGAGAAACTAAGCAGTTCTCTTCATGATGATGGTCTTATAGGGAAGGATGAGTTCCTCCTGGCATTATTCAGGGATCATGGCCAAAGAAACCTGTTTGCAGATAGGATATTTGATCTTTTTGATGTGAATAGAAGTGGGCA...

CDS

Download CDS FASTA

651 bp · LXL04_026643|LXL04_026643|OH1004|CDS

ATGGGTTGTTTTTGTTCAACTCCTCATAGCTACAGAAAAGCACCTCCCTTTGATCCTGTTGCACTTGCTGCTGAGACTCCTTTTACTGAAAATGAGGTGGAGGCTCTATATGAGCTGTTTGAGAAACTAAGCAGTTCTCTTCATGATGATGGTCTTATAGGGAAGGATGAGTTCCTCCTGGCATTATTCAGGGATCATGGCCAAAGAAACCTGTTTGCAGATAGGATATTTGATCTTTTTGATGTGAATAGAAGTGGGCA...

Protein

Download Protein FASTA

216 aa · LXL04_026643|LXL04_026643|OH1004|PROTEIN

MGCFCSTPHSYRKAPPFDPVALAAETPFTENEVEALYELFEKLSSSLHDDGLIGKDEFLLALFRDHGQRNLFADRIFDLFDVNRSGHIDFTEFVRSLGVFHPKAPQADKILYAFKLYDLRRTGFIEREELKEMVSALLKESDLSLSDDIIESMVDKTFTEADTKGDGRIDQEEWKEYVNKNPSLLKNMTLPHLMDITLRFPSFVMNSQVEESHTTD

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026643`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026643

Location Chr06:805816-807111 (-)

Description Similar to CBL4: Calcineurin B-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24270`	May act as a calcium sensor regulating intracellular Na⁺/K⁺ homeostasis and salt tolerance.	The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3.2000 · DOI: 10.1073/pnas.97.7.3735 SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding.2000 · DOI: 10.1105/tpc.12.9.1667 Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3.2002 · DOI: 10.1073/pnas.122224699 Calcium-dependent modulation and plasma membrane targeting of the AKT2 potassium channel by the CBL4/CIPK6 calcium sensor/protein kinase complex.2011 · DOI: 10.1038/cr.2011.50 Arabidopsis SOS3 plays an important role in salt tolerance by mediating calcium-dependent microfilament reorganization.2013 · DOI: 10.1007/s00299-012-1348-3

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0291000`	Acts as a calcium sensor.	No verified direct reference in this release
`Os05g0534400`	Acts as a calcium sensor involved in the regulatory pathway for the control of intracellular Na(+) and K(+) homeostasis and salt tolerance.	Conservation of the salt overly sensitive pathway in rice.2007 · DOI: 10.1104/pp.106.092635
`Os02g0291400`	Acts as a calcium sensor.	Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses.2008 · DOI: 10.1016/j.gene.2008.02.011
`Os10g0564800`	Acts as a calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026643 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005513 detection of calcium ion Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0030007 intracellular potassium ion homeostasis Biological Process

GO:0042539 hypotonic salinity response Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005955 calcineurin complex Cellular Component

GO:0032578 aleurone grain membrane Cellular Component

GO:0004723 calcium-dependent protein serine/threonine phosphatase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G24270

dosa:Os02g0291000

dosa:Os05g0534400

osa:107276173

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.451

Rank 1 · LXL04_026643 · OH-1004

Cytoplasm0.380

Rank 2 · LXL04_026643 · OH-1004

Nucleus0.158

Rank 3 · LXL04_026643 · OH-1004

Lysosome / Vacuole0.115

Rank 4 · LXL04_026643 · OH-1004

Golgi apparatus0.094

Rank 5 · LXL04_026643 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499.13EF-hand_749-95 aa

PF30347.1RSA-1_C60-139 aa

PF00036.39EF-hand_174-95 aa

PF13202.13EF-hand_574-95 aa

PF13405.13EF-hand_675-97 aa

PF13499.13EF-hand_7108-177 aa

PF13405.13EF-hand_6110-136 aa

PF00036.39EF-hand_1111-136 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026643	`PF13499.13`	EF-hand_7	49	95	3.5e-18	66.4
LXL04_026643	`PF30347.1`	RSA-1_C	60	139	9.4e-06	26.6
LXL04_026643	`PF00036.39`	EF-hand_1	74	95	7e-21	72.9
LXL04_026643	`PF13202.13`	EF-hand_5	74	95	1.4e-15	56.7
LXL04_026643	`PF13405.13`	EF-hand_6	75	97	1.7e-17	62.1
LXL04_026643	`PF13499.13`	EF-hand_7	108	177	3.5e-18	66.4
LXL04_026643	`PF13405.13`	EF-hand_6	110	136	1.7e-17	62.1
LXL04_026643	`PF00036.39`	EF-hand_1	111	136	7e-21	72.9
LXL04_026643	`PF13833.13`	EF-hand_8	123	180	2.8e-10	40.5
LXL04_026643	`PF00036.39`	EF-hand_1	154	180	7e-21	72.9
LXL04_026643	`PF13202.13`	EF-hand_5	155	176	1.4e-15	56.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81223`	Arabidopsis thaliana	Calcineurin B-like protein 4	64.953%	Swiss-Prot	strong database homology
`Q3HRP0`	Oryza sativa subsp. japonica	Calcineurin B-like protein 7	62.559%	Swiss-Prot	strong database homology
`Q75KU4`	Oryza sativa subsp. japonica	Calcineurin B-like protein 4	60.194%	Swiss-Prot	strong database homology
`Q3HRN9`	Oryza sativa subsp. japonica	Calcineurin B-like protein 8	61.137%	Swiss-Prot	strong database homology
`Q7XC27`	Oryza sativa subsp. japonica	Calcineurin B-like protein 1	59.535%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card