Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1254 bp · TkAUNG066120|TK1151|cDNA
ATGGAAAATGCTAATCACTTATCTCCCCTGCAGACTAAGAAGCGGAAGTTTTCGCCGATTGTTTGGGATAGAGATGATAGAGAGGTAAGCAGATCAAATAAAAGTAGAAATACACTGGATACTACTAACACTTCCACGCCATCACCCCGATTGGTTGAGTTGAATCGCCGATCACCTTTCCCGGAACCTACTCCAGATGAAAATGTGGAGACTTCAGTCACAGATGGAGATGAAGGTGAGATTTCTGATTACGAAAATGT...
1254 bp · TkAUNG066120|TK1151|CDS
ATGGAAAATGCTAATCACTTATCTCCCCTGCAGACTAAGAAGCGGAAGTTTTCGCCGATTGTTTGGGATAGAGATGATAGAGAGGTAAGCAGATCAAATAAAAGTAGAAATACACTGGATACTACTAACACTTCCACGCCATCACCCCGATTGGTTGAGTTGAATCGCCGATCACCTTTCCCGGAACCTACTCCAGATGAAAATGTGGAGACTTCAGTCACAGATGGAGATGAAGGTGAGATTTCTGATTACGAAAATGT...
Protein
Download Protein FASTA417 aa · TkAUNG066120|TK1151|PROTEIN
MENANHLSPLQTKKRKFSPIVWDRDDREVSRSNKSRNTLDTTNTSTPSPRLVELNRRSPFPEPTPDENVETSVTDGDEGEISDYENVANSRRKSSSEFGEVRGHSKSISPEVGDVKREGSEGTRGRSLGSDERVRSSSRDSYQDNDDNTDSMEIDDDRHHDGARFSHSETGSEDDHGSPGTPEPAQPPQRSVNMLQGCRSVDEFERLNKIDEGTYGVVFRARDKKTGEIVALKKVKMEKEREGFPMTSLREINILLSFDH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG066120 |
|---|---|
| TK1151 ID | TkAUNG066120 |
| OH-1004 ID | LXL04_035707 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 51.300 |
| Protein coverage (%) | TK1151 52.518 / OH-1004 43.015Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG066120 | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | ChrUn:19230470-19232412 (-) | |||||||||||||||
| Description | Similar to CDKC-1: Cyclin-dependent kinase C-1 | |||||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. Rice
| |||||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||||||||
| GO annotations (OH1004 source) | GO:0006397 mRNA processing Biological Process GO:0009414 response to water deprivation Biological Process GO:0009615 response to virus Biological Process GO:0009908 flower development Biological Process GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process GO:0048440 carpel development Biological Process GO:0050792 regulation of viral process Biological Process GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component GO:0005634 nucleus Cellular Component GO:0016604 nuclear body Cellular Component GO:0004693 cyclin-dependent protein serine/threonine kinase activity Molecular Function GO:0005524 ATP binding Molecular Function | |||||||||||||||
| KEGG gene cross-reference | ath:AT5G10270 ath:AT5G64960 dosa:Os01g0958000 dosa:Os05g0389700 osa:9268645 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00069Pkinase204-411 aaPF14531Kinase-like206-245 aaPF07714PK_Tyr_Ser-Thr207-400 aaPF03109ABC1216-234 aaPF21208euk_SelB_III246-277 aaPF06293Kdo261-344 aaPF25593GldD_lipo273-297 aaPF01163RIO1277-348 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkAUNG066120 | PF00069 | Pkinase | 204 | 411 | 1e-63 | 215.9 |
| TkAUNG066120 | PF14531 | Kinase-like | 206 | 245 | 3.9e-07 | 30.4 |
| TkAUNG066120 | PF07714 | PK_Tyr_Ser-Thr | 207 | 400 | 6.7e-35 | 121.4 |
| TkAUNG066120 | PF03109 | ABC1 | 216 | 234 | 1.5e-05 | 25.0 |
| TkAUNG066120 | PF21208 | euk_SelB_III | 246 | 277 | 0.065 | 14.5 |
| TkAUNG066120 | PF06293 | Kdo | 261 | 344 | 0.076 | 13.2 |
| TkAUNG066120 | PF25593 | GldD_lipo | 273 | 297 | 0.084 | 13.5 |
| TkAUNG066120 | PF01163 | RIO1 | 277 | 348 | 0.032 | 14.5 |
| TkAUNG066120 | PF14531 | Kinase-like | 278 | 391 | 3.9e-07 | 30.4 |
| TkAUNG066120 | PF03109 | ABC1 | 279 | 356 | 1.5e-05 | 25.0 |
| TkAUNG066120 | PF12330 | Haspin_kinase | 326 | 353 | 0.065 | 13.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
A2XUW1 | Oryza sativa subsp. indica | sp|A2XUW1|CDKG2_ORYSI Cyclin-dependent kinase G-2 | 58.200% | Swiss-Prot | High |
Q7XUF4 | Oryza sativa subsp. japonica | sp|Q7XUF4|CDKG2_ORYSJ Cyclin-dependent kinase G-2 | 58.200% | Swiss-Prot | High |
A2X6X1 | Oryza sativa subsp. indica | sp|A2X6X1|CDKG1_ORYSI Cyclin-dependent kinase G-1 | 87.200% | Swiss-Prot | Medium |
Q6K5F8 | Oryza sativa subsp. japonica | sp|Q6K5F8|CDKG1_ORYSJ Cyclin-dependent kinase G-1 | 87.200% | Swiss-Prot | Medium |