TkAUNG064970 | RubberDandelionOmics

Gene overview

TkAUNG064970

Reference: TK1151 Chr: ChrUn Coordinates: 18887136-18892282 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2892 bp · TkAUNG064970|TK1151|cDNA

AAAAACATCAAAAAGCAGAGCTGCTCTGAGCTCCTCCGACTGAAATAATGGAAGGAAGAAGGCTATTCGACGAAGGAGCCGCCATACATTCGGATTCCGATAACCGAAGCTCCATGGTACGGCATACTACTGGTCATCCCTCACTTCAACCCAACTACAGCTGCCAGAAAGTCCAGAAAGCACTGGAGAACTTGGCATCCATTGATTTGAGTGAGCTGTGCAATGAAGCAAAAGTTGAGCATTGTCGAGCTACAAGGGAC...

CDS

Download CDS FASTA

1401 bp · TkAUNG064970|TK1151|CDS

ATGGTGGTTGCTAAACAAGCAATTCTTTTGTATTATTTATTTGACCGAATGTGGAAAATACCTGATGACAAATGGAGGTATTGTGTGGACGACTTCTCTGCTACATTCAGTATAGCCAGACACTTGATATTGGAATCATTTACTTTCTATCTCCTTGATGACCATAGTGATGAAGCCCTTCAGGAAGCATGCCGTCTTCTTCCAGAGATATCGGGCCCCACAACACATCCAAAAGTAGCACAAGTTCTACTAGAAAGACA...

Protein

Download Protein FASTA

466 aa · TkAUNG064970|TK1151|PROTEIN

MVVAKQAILLYYLFDRMWKIPDDKWRYCVDDFSATFSIARHLILESFTFYLLDDHSDEALQEACRLLPEISGPTTHPKVAQVLLERQNPYAALMVLRWSGTDTATDLPSLNQAVTAVRVRVECGLLLEAFMHQRSISTKFKKTKSRNELPSFDDSENEVDWLEVLVTEICILCIRRNLVDRIIGLPWNFEEEKHLHKCLLDYASDEPLTNTGSLLVVYYLQRYRYLEAYQVDRKLQSIENEFVSRNPINDDVANRMSFIQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG064970`
TK1151 ID	TkAUNG064970
OH-1004 ID	LXL04_029788
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 53.749 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG064970

Location ChrUn:18887136-18892282 (-)

Description Similar to HOS1: E3 ubiquitin-protein ligase HOS1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39810`	E3 ubiquitin-protein ligase that mediates ubiquitination and subsequent proteasomal degradation of the transcription factor ICE1.	The negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1.2006 · DOI: 10.1073/pnas.0602874103 The E3 ubiquitin ligase HOS1 regulates low ambient temperature-responsive flowering in Arabidopsis thaliana.2012 · DOI: 10.1093/pcp/pcs123

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029788 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0015031 protein transport Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0051028 mRNA transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0004842 ubiquitin-protein transferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G39810

xla:397707

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.728

Rank 1 · TkAUNG064970 · TK1151

Cytoplasm0.236

Rank 2 · TkAUNG064970 · TK1151

Cell membrane0.063

Rank 3 · TkAUNG064970 · TK1151

Endoplasmic reticulum0.036

Rank 4 · TkAUNG064970 · TK1151

Golgi apparatus0.033

Rank 5 · TkAUNG064970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13934ELYS3-201 aa

PF13934ELYS217-240 aa

PF13934ELYS388-420 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG064970	`PF13934`	ELYS	3	201	1.3e-32	114.1
TkAUNG064970	`PF13934`	ELYS	217	240	1.3e-32	114.1
TkAUNG064970	`PF13934`	ELYS	388	420	1.3e-32	114.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JU6`	Arabidopsis thaliana	sp\|Q84JU6\|HOS1_ARATH E3 ubiquitin-protein ligase HOS1	48.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card