TkAUNG064000 | RubberDandelionOmics

Gene overview

TkAUNG064000

Reference: TK1151 Chr: ChrUn Coordinates: 18502715-18505207 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1659 bp · TkAUNG064000|TK1151|cDNA

ATGGTGGCGAAAGATTATCAAAAAGTAAAAGCATCAAGTAAAGCTGAGGTGGGAGAAATTGATACCAGTGCACCCTTCCAATCTGTCAAAGATGCTGTTAGCTTATTTGGTGAAGGTTCATTTCAGGGGAAAAGCCAGCCATTAGAAAGCCTAAAGCACATTCTACAGAAGGCACTGGCAAAAGAGACACAGCTTCACTTAACCCAGAAAGAGTTGAATAAGTTGAAGGAACAATTGAAAAATGCTGAGACCACTAAAGC...

CDS

Download CDS FASTA

1659 bp · TkAUNG064000|TK1151|CDS

ATGGTGGCGAAAGATTATCAAAAAGTAAAAGCATCAAGTAAAGCTGAGGTGGGAGAAATTGATACCAGTGCACCCTTCCAATCTGTCAAAGATGCTGTTAGCTTATTTGGTGAAGGTTCATTTCAGGGGAAAAGCCAGCCATTAGAAAGCCTAAAGCACATTCTACAGAAGGCACTGGCAAAAGAGACACAGCTTCACTTAACCCAGAAAGAGTTGAATAAGTTGAAGGAACAATTGAAAAATGCTGAGACCACTAAAGC...

Protein

Download Protein FASTA

552 aa · TkAUNG064000|TK1151|PROTEIN

MVAKDYQKVKASSKAEVGEIDTSAPFQSVKDAVSLFGEGSFQGKSQPLESLKHILQKALAKETQLHLTQKELNKLKEQLKNAETTKAQALSELEKAKQTVEDLSQKLNIINESKDSAIRATEVAKHQANQFAEASDNDSDAMNESLNMDLESTRAQCLDAAIELDAAKQELRQIRQEYDSSMEAKDSIQQVKLANVQSKEEETKIYEEKGNEKQLYKLKLEEAAKKLLALRKDMNPELTKNLEAQLSETLSEVEALRKES...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG064000`
TK1151 ID	TkAUNG064000
OH-1004 ID	LXL04_016143
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	35.400
Protein coverage (%)	TK1151 99.819 / OH-1004 94.659 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG064000

Location ChrUn:18502715-18505207 (-)

Description Similar to At5g55860: WEB family protein At5g55860

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55860`	WEB family protein At5g55860.	No verified direct reference in this release
`At1g12150`	WEB family protein At1g12150.	No verified direct reference in this release
`At4g17210`	Putative WEB family protein At4g17210.	No verified direct reference in this release
`At3g13190`	WEB family protein At3g13190.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016143 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009903 chloroplast avoidance movement Biological Process

GO:0009904 chloroplast accumulation movement Biological Process

GO:0071260 cellular response to mechanical stimulus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G12150

ath:AT2G26570

ath:AT4G17210

ath:AT4G33390

ath:AT5G55860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.530

Rank 1 · TkAUNG064000 · TK1151

Cell membrane0.332

Rank 2 · TkAUNG064000 · TK1151

Nucleus0.264

Rank 3 · TkAUNG064000 · TK1151

Endoplasmic reticulum0.051

Rank 4 · TkAUNG064000 · TK1151

Plastid0.050

Rank 5 · TkAUNG064000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05701WEMBL19-205 aa

PF24161CCDC3951-312 aa

PF26095CC_Bre151-110 aa

PF24423OVT162-133 aa

PF15294Leu_zip65-173 aa

PF24423OVT1112-196 aa

PF26095CC_Bre1129-182 aa

PF24423OVT1140-190 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG064000	`PF05701`	WEMBL	19	205	1.5e-33	117.1
TkAUNG064000	`PF24161`	CCDC39	51	312	0.89	8.0
TkAUNG064000	`PF26095`	CC_Bre1	51	110	7.6	7.6
TkAUNG064000	`PF24423`	OVT1	62	133	0.026	15.6
TkAUNG064000	`PF15294`	Leu_zip	65	173	0.0045	17.3
TkAUNG064000	`PF24423`	OVT1	112	196	0.026	15.6
TkAUNG064000	`PF26095`	CC_Bre1	129	182	7.6	7.6
TkAUNG064000	`PF24423`	OVT1	140	190	0.026	15.6
TkAUNG064000	`PF15294`	Leu_zip	197	281	0.0045	17.3
TkAUNG064000	`PF05701`	WEMBL	216	438	1.5e-33	117.1
TkAUNG064000	`PF26095`	CC_Bre1	226	307	7.6	7.6
TkAUNG064000	`PF24423`	OVT1	240	307	0.026	15.6
TkAUNG064000	`PF15294`	Leu_zip	272	384	0.0045	17.3
TkAUNG064000	`PF15294`	Leu_zip	299	447	0.0045	17.3
TkAUNG064000	`PF26095`	CC_Bre1	320	394	7.6	7.6
TkAUNG064000	`PF24423`	OVT1	333	388	0.026	15.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVQ4`	Arabidopsis thaliana	sp\|Q9LVQ4\|Y5586_ARATH WEB family protein At5g55860	39.200%	Swiss-Prot	Medium
`Q9FWW5`	Arabidopsis thaliana	sp\|Q9FWW5\|Y1215_ARATH WEB family protein At1g12150	40.100%	Swiss-Prot	Medium
`O23564`	Arabidopsis thaliana	sp\|O23564\|Y4721_ARATH Putative WEB family protein At4g17210	30.300%	Swiss-Prot	Medium
`Q9LK53`	Arabidopsis thaliana	sp\|Q9LK53\|Y3319_ARATH WEB family protein At3g13190	28.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card