TkAUNG047410 | RubberDandelionOmics

Gene overview

TkAUNG047410

Reference: TK1151 Chr: ChrUn Coordinates: 13138421-13140545 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1644 bp · TkAUNG047410|TK1151|cDNA

AAAAAGAGCAGCAAAAAGAACCCTAACGAAACGCCACCGACCTCTGTTTTCACTACGGCGGTTCGGTACTGCACACCTTCGCTCTACAAGACCTCCGAGCTCGAATGTCGACTCTCTTCTCTCGTTATCTTCACACCATTTCATCCACATCGCCATCTAAATCCTCCATTATAACTTACCTCACAGAATCCTTAGGATTTTCCAAATTACGAGCCGTCTCAATATCTACTCGATTTTCATCCCCAGATACCAACCCACAA...

CDS

Download CDS FASTA

1083 bp · TkAUNG047410|TK1151|CDS

ATGTCGACTCTCTTCTCTCGTTATCTTCACACCATTTCATCCACATCGCCATCTAAATCCTCCATTATAACTTACCTCACAGAATCCTTAGGATTTTCCAAATTACGAGCCGTCTCAATATCTACTCGATTTTCATCCCCAGATACCAACCCACAAACCGTTATTGAGCTCTTGAACTCTCTCGGATTCAGCAACAACGATATTCAAACTTGGATAAATGCATCTCCTCAAATCCTTTTCATAGACGCCGAAAAAGCCCT...

Protein

Download Protein FASTA

360 aa · TkAUNG047410|TK1151|PROTEIN

MSTLFSRYLHTISSTSPSKSSIITYLTESLGFSKLRAVSISTRFSSPDTNPQTVIELLNSLGFSNNDIQTWINASPQILFIDAEKALKPRILYFQDLGLAGSELGKFISKNPSFLSDRFERIKPCVDVLKTLMINDHANENLLRTLRRCNWADIKQPVTRISANIKYLEQCGIVGSQLATIISRQPRLIIRGESELKDLVSKVLKMGFSIDSRMLVHALYSFSCLSDETIKRKHELFQSVGFTKAECLVMFKKAPALLRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG047410`
TK1151 ID	TkAUNG047410
OH-1004 ID	LXL04_023156
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkAUNG047410`
Location	ChrUn:13138421-13140545 (-)
Description	Similar to MTERF4: Transcription termination factor MTERF4, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023156` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006353 DNA-templated transcription termination Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006393 termination of mitochondrial transcription Biological Process GO:0006970 response to osmotic stress Biological Process GO:0008380 RNA splicing Biological Process GO:0009651 response to salt stress Biological Process GO:0009658 chloroplast organization Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process GO:0015979 photosynthesis Biological Process GO:0032502 developmental process Biological Process GO:0042793 plastid transcription Biological Process
KEGG gene cross-reference	ath:AT2G21710 ath:AT4G02990 ath:AT4G14605 ath:AT5G54180 dosa:Os05g0404000 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.643

Rank 1 · TkAUNG047410 · TK1151

Plastid0.227

Rank 2 · TkAUNG047410 · TK1151

Nucleus0.042

Rank 3 · TkAUNG047410 · TK1151

Cytoplasm0.036

Rank 4 · TkAUNG047410 · TK1151

Cell membrane0.007

Rank 5 · TkAUNG047410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09280XPC-binding49-77 aa

PF02536mTERF55-136 aa

PF09280XPC-binding107-115 aa

PF02536mTERF121-331 aa

PF09280XPC-binding177-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG047410	`PF09280`	XPC-binding	49	77	0.36	11.2
TkAUNG047410	`PF02536`	mTERF	55	136	5.2e-36	124.9
TkAUNG047410	`PF09280`	XPC-binding	107	115	0.36	11.2
TkAUNG047410	`PF02536`	mTERF	121	331	5.2e-36	124.9
TkAUNG047410	`PF09280`	XPC-binding	177	188	0.36	11.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card