LXL04_023156 | RubberDandelionOmics

Gene overview

LXL04_023156

Reference: OH-1004 Chr: Chr05 Coordinates: 25055073-25056155 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1083 bp · LXL04_023156|LXL04_023156|OH1004|cDNA

ATGTCGACTCTCTTCTCTCGTTATCTTCACACCATTTCATCCACATCGCCATCTAAATCCTCCATTATAACTTACCTCACAGAATCCTTAGGATTTTCCAAATTACGAGCCGTCTCAATATCTACTCGATTTTCATCCCCAGATACCAACCCACAAACCGTTATTGAGCTCTTGAACTCTCTCGGATTCAGCAACAACGATATTCAAACTTGGATAAATGCATCTCCTCAAATCCTTTTCATAGACGCCGAAAAAGCCCT...

CDS

Download CDS FASTA

1083 bp · LXL04_023156|LXL04_023156|OH1004|CDS

ATGTCGACTCTCTTCTCTCGTTATCTTCACACCATTTCATCCACATCGCCATCTAAATCCTCCATTATAACTTACCTCACAGAATCCTTAGGATTTTCCAAATTACGAGCCGTCTCAATATCTACTCGATTTTCATCCCCAGATACCAACCCACAAACCGTTATTGAGCTCTTGAACTCTCTCGGATTCAGCAACAACGATATTCAAACTTGGATAAATGCATCTCCTCAAATCCTTTTCATAGACGCCGAAAAAGCCCT...

Protein

Download Protein FASTA

360 aa · LXL04_023156|LXL04_023156|OH1004|PROTEIN

MSTLFSRYLHTISSTSPSKSSIITYLTESLGFSKLRAVSISTRFSSPDTNPQTVIELLNSLGFSNNDIQTWINASPQILFIDAEKALKPRILYFQDLGLAGSELGKFISKNPSFLSDRFERIKPCVDVLKTLMINDHANENLLRTLRRCNWADIKQPVTRISANIKYLEQCGIVGSQLATIISRQPRLIIRGESELKDLVSKVLKMGFSIDSRMLVHALYSFSCLSDETIKRKHELFQSVGFTKAECLVMFKKAPALLRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023156`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023156

Location Chr05:25055073-25056155 (+)

Description Similar to MTERF4: Transcription termination factor MTERF4, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g02990`	Transcription termination factor required for processing and steady-state levels of plastid transcripts.	No verified direct reference in this release
`At4g14605`	Transcription termination factor required for processing and steady-state levels of plastid transcripts.	Arabidopsis MDA1, a nuclear-encoded protein, functions in chloroplast development and abiotic stress responses.2012 · DOI: 10.1371/journal.pone.0042924 mTERF5 Acts as a Transcriptional Pausing Factor to Positively Regulate Transcription of Chloroplast psbEFLJ.2019 · DOI: 10.1016/j.molp.2019.05.007
`At5g54180`	Transcription termination factor that is transcriptionally active in chloroplasts.	No verified direct reference in this release
`At2g21710`	Transcription termination factor involved in processing of plastid transcripts (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0404000`	Transcription termination factor required for processing and steady-state levels of plastid transcripts.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023156 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006353 DNA-templated transcription termination Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006393 termination of mitochondrial transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0015979 photosynthesis Biological Process

GO:0032502 developmental process Biological Process

GO:0042793 plastid transcription Biological Process

KEGG gene cross-reference

ath:AT2G21710

ath:AT4G02990

ath:AT4G14605

ath:AT5G54180

dosa:Os05g0404000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.643

Rank 1 · LXL04_023156 · OH-1004

Plastid0.227

Rank 2 · LXL04_023156 · OH-1004

Nucleus0.042

Rank 3 · LXL04_023156 · OH-1004

Cytoplasm0.036

Rank 4 · LXL04_023156 · OH-1004

Cell membrane0.007

Rank 5 · LXL04_023156 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02536.20mTERF55-136 aa

PF02536.20mTERF121-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023156	`PF02536.20`	mTERF	55	136	5.2e-36	124.9
LXL04_023156	`PF02536.20`	mTERF	121	331	5.2e-36	124.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZT96`	Arabidopsis thaliana	Transcription termination factor MTERF4, chloroplastic	23.906%	Swiss-Prot	weak database homology
`F4JVI3`	Arabidopsis thaliana	Transcription termination factor MTERF5, chloroplastic	24.254%	Swiss-Prot	weak database homology
`Q9FK23`	Arabidopsis thaliana	Transcription termination factor MTERF8, chloroplastic	21.888%	Swiss-Prot	weak database homology
`F4IHL3`	Arabidopsis thaliana	Transcription termination factor MTERF2, chloroplastic	20.323%	Swiss-Prot	weak database homology
`Q6AUK6`	Oryza sativa subsp. japonica	Transcription termination factor MTERF4, chloroplastic	22.394%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card